ID: 1124190542

View in Genome Browser
Species Human (GRCh38)
Location 15:27572834-27572856
Sequence ACATATTCCTTTCAAAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124190542_1124190544 -10 Left 1124190542 15:27572834-27572856 CCCATGTTTTGAAAGGAATATGT No data
Right 1124190544 15:27572847-27572869 AGGAATATGTGTGCTGCAGTTGG No data
1124190542_1124190545 -6 Left 1124190542 15:27572834-27572856 CCCATGTTTTGAAAGGAATATGT No data
Right 1124190545 15:27572851-27572873 ATATGTGTGCTGCAGTTGGATGG No data
1124190542_1124190547 -4 Left 1124190542 15:27572834-27572856 CCCATGTTTTGAAAGGAATATGT No data
Right 1124190547 15:27572853-27572875 ATGTGTGCTGCAGTTGGATGGGG No data
1124190542_1124190548 16 Left 1124190542 15:27572834-27572856 CCCATGTTTTGAAAGGAATATGT No data
Right 1124190548 15:27572873-27572895 GGGTTTTCCCATGTTTTGAAAGG No data
1124190542_1124190546 -5 Left 1124190542 15:27572834-27572856 CCCATGTTTTGAAAGGAATATGT No data
Right 1124190546 15:27572852-27572874 TATGTGTGCTGCAGTTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124190542 Original CRISPR ACATATTCCTTTCAAAACAT GGG (reversed) Intergenic
No off target data available for this crispr