ID: 1124190545

View in Genome Browser
Species Human (GRCh38)
Location 15:27572851-27572873
Sequence ATATGTGTGCTGCAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124190543_1124190545 -7 Left 1124190543 15:27572835-27572857 CCATGTTTTGAAAGGAATATGTG No data
Right 1124190545 15:27572851-27572873 ATATGTGTGCTGCAGTTGGATGG No data
1124190542_1124190545 -6 Left 1124190542 15:27572834-27572856 CCCATGTTTTGAAAGGAATATGT No data
Right 1124190545 15:27572851-27572873 ATATGTGTGCTGCAGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124190545 Original CRISPR ATATGTGTGCTGCAGTTGGA TGG Intergenic
No off target data available for this crispr