ID: 1124190552

View in Genome Browser
Species Human (GRCh38)
Location 15:27572897-27572919
Sequence ATATGTGTGCTGCAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124190549_1124190552 -6 Left 1124190549 15:27572880-27572902 CCCATGTTTTGAAAGGAATATGT No data
Right 1124190552 15:27572897-27572919 ATATGTGTGCTGCAGTTGGATGG No data
1124190550_1124190552 -7 Left 1124190550 15:27572881-27572903 CCATGTTTTGAAAGGAATATGTG No data
Right 1124190552 15:27572897-27572919 ATATGTGTGCTGCAGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124190552 Original CRISPR ATATGTGTGCTGCAGTTGGA TGG Intergenic
No off target data available for this crispr