ID: 1124190557

View in Genome Browser
Species Human (GRCh38)
Location 15:27572927-27572949
Sequence CACATATTCCTTTCAAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124190557_1124190566 27 Left 1124190557 15:27572927-27572949 CCATGTTTTGAAAGGAATATGTG No data
Right 1124190566 15:27572977-27572999 CATGGGACCCAGTTGATTGATGG No data
1124190557_1124190563 10 Left 1124190557 15:27572927-27572949 CCATGTTTTGAAAGGAATATGTG No data
Right 1124190563 15:27572960-27572982 GGATGGGGTCCCATGTTCATGGG No data
1124190557_1124190559 -7 Left 1124190557 15:27572927-27572949 CCATGTTTTGAAAGGAATATGTG No data
Right 1124190559 15:27572943-27572965 ATATGTGTGCTGCAGTTGGATGG No data
1124190557_1124190560 -6 Left 1124190557 15:27572927-27572949 CCATGTTTTGAAAGGAATATGTG No data
Right 1124190560 15:27572944-27572966 TATGTGTGCTGCAGTTGGATGGG No data
1124190557_1124190561 -5 Left 1124190557 15:27572927-27572949 CCATGTTTTGAAAGGAATATGTG No data
Right 1124190561 15:27572945-27572967 ATGTGTGCTGCAGTTGGATGGGG No data
1124190557_1124190562 9 Left 1124190557 15:27572927-27572949 CCATGTTTTGAAAGGAATATGTG No data
Right 1124190562 15:27572959-27572981 TGGATGGGGTCCCATGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124190557 Original CRISPR CACATATTCCTTTCAAAACA TGG (reversed) Intergenic
No off target data available for this crispr