ID: 1124190566

View in Genome Browser
Species Human (GRCh38)
Location 15:27572977-27572999
Sequence CATGGGACCCAGTTGATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124190557_1124190566 27 Left 1124190557 15:27572927-27572949 CCATGTTTTGAAAGGAATATGTG No data
Right 1124190566 15:27572977-27572999 CATGGGACCCAGTTGATTGATGG No data
1124190556_1124190566 28 Left 1124190556 15:27572926-27572948 CCCATGTTTTGAAAGGAATATGT No data
Right 1124190566 15:27572977-27572999 CATGGGACCCAGTTGATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124190566 Original CRISPR CATGGGACCCAGTTGATTGA TGG Intergenic
No off target data available for this crispr