ID: 1124190710

View in Genome Browser
Species Human (GRCh38)
Location 15:27574257-27574279
Sequence AGGTGGCGCTGCGGCGGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124190699_1124190710 9 Left 1124190699 15:27574225-27574247 CCTATTCTGGGAGCTGGTGGCCT 0: 1
1: 0
2: 1
3: 19
4: 192
Right 1124190710 15:27574257-27574279 AGGTGGCGCTGCGGCGGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124190710 Original CRISPR AGGTGGCGCTGCGGCGGGTC GGG Intergenic
No off target data available for this crispr