ID: 1124191383

View in Genome Browser
Species Human (GRCh38)
Location 15:27580162-27580184
Sequence ACTGAAGTCCAGATCTTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124191379_1124191383 -3 Left 1124191379 15:27580142-27580164 CCCAGCTCTCTTTGTGTCCCACT No data
Right 1124191383 15:27580162-27580184 ACTGAAGTCCAGATCTTACCTGG No data
1124191376_1124191383 18 Left 1124191376 15:27580121-27580143 CCTTCATCATGGCCTCAGTGCCC No data
Right 1124191383 15:27580162-27580184 ACTGAAGTCCAGATCTTACCTGG No data
1124191380_1124191383 -4 Left 1124191380 15:27580143-27580165 CCAGCTCTCTTTGTGTCCCACTG No data
Right 1124191383 15:27580162-27580184 ACTGAAGTCCAGATCTTACCTGG No data
1124191378_1124191383 -2 Left 1124191378 15:27580141-27580163 CCCCAGCTCTCTTTGTGTCCCAC No data
Right 1124191383 15:27580162-27580184 ACTGAAGTCCAGATCTTACCTGG No data
1124191377_1124191383 6 Left 1124191377 15:27580133-27580155 CCTCAGTGCCCCAGCTCTCTTTG No data
Right 1124191383 15:27580162-27580184 ACTGAAGTCCAGATCTTACCTGG No data
1124191375_1124191383 19 Left 1124191375 15:27580120-27580142 CCCTTCATCATGGCCTCAGTGCC No data
Right 1124191383 15:27580162-27580184 ACTGAAGTCCAGATCTTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124191383 Original CRISPR ACTGAAGTCCAGATCTTACC TGG Intergenic
No off target data available for this crispr