ID: 1124193655

View in Genome Browser
Species Human (GRCh38)
Location 15:27601413-27601435
Sequence GCCTTGCGGTTGTTTCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124193655_1124193657 -8 Left 1124193655 15:27601413-27601435 CCAGGTTGAAACAACCGCAAGGC No data
Right 1124193657 15:27601428-27601450 CGCAAGGCTGAAGCCCAAGCTGG No data
1124193655_1124193664 23 Left 1124193655 15:27601413-27601435 CCAGGTTGAAACAACCGCAAGGC No data
Right 1124193664 15:27601459-27601481 CAGCTGGGCCATGAGTTAGCTGG No data
1124193655_1124193661 7 Left 1124193655 15:27601413-27601435 CCAGGTTGAAACAACCGCAAGGC No data
Right 1124193661 15:27601443-27601465 CAAGCTGGAGGTGCACCAGCTGG No data
1124193655_1124193662 8 Left 1124193655 15:27601413-27601435 CCAGGTTGAAACAACCGCAAGGC No data
Right 1124193662 15:27601444-27601466 AAGCTGGAGGTGCACCAGCTGGG No data
1124193655_1124193658 -5 Left 1124193655 15:27601413-27601435 CCAGGTTGAAACAACCGCAAGGC No data
Right 1124193658 15:27601431-27601453 AAGGCTGAAGCCCAAGCTGGAGG No data
1124193655_1124193665 28 Left 1124193655 15:27601413-27601435 CCAGGTTGAAACAACCGCAAGGC No data
Right 1124193665 15:27601464-27601486 GGGCCATGAGTTAGCTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124193655 Original CRISPR GCCTTGCGGTTGTTTCAACC TGG (reversed) Intergenic