ID: 1124198968

View in Genome Browser
Species Human (GRCh38)
Location 15:27660243-27660265
Sequence GTTCCCTCCCCCGGTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124198968_1124198972 14 Left 1124198968 15:27660243-27660265 CCAGAATCACCGGGGGAGGGAAC No data
Right 1124198972 15:27660280-27660302 TCTGCACTGAGATGACCGCTGGG No data
1124198968_1124198971 13 Left 1124198968 15:27660243-27660265 CCAGAATCACCGGGGGAGGGAAC No data
Right 1124198971 15:27660279-27660301 GTCTGCACTGAGATGACCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124198968 Original CRISPR GTTCCCTCCCCCGGTGATTC TGG (reversed) Intergenic
No off target data available for this crispr