ID: 1124199466

View in Genome Browser
Species Human (GRCh38)
Location 15:27665949-27665971
Sequence GATCTCTCCTTGGCCAGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124199466_1124199475 0 Left 1124199466 15:27665949-27665971 CCCGGACTGGCCAAGGAGAGATC No data
Right 1124199475 15:27665972-27665994 CCTGCTGGTTTCCAGGAGTGGGG No data
1124199466_1124199470 -7 Left 1124199466 15:27665949-27665971 CCCGGACTGGCCAAGGAGAGATC No data
Right 1124199470 15:27665965-27665987 AGAGATCCCTGCTGGTTTCCAGG No data
1124199466_1124199476 10 Left 1124199466 15:27665949-27665971 CCCGGACTGGCCAAGGAGAGATC No data
Right 1124199476 15:27665982-27666004 TCCAGGAGTGGGGCCTGAGCTGG No data
1124199466_1124199473 -1 Left 1124199466 15:27665949-27665971 CCCGGACTGGCCAAGGAGAGATC No data
Right 1124199473 15:27665971-27665993 CCCTGCTGGTTTCCAGGAGTGGG No data
1124199466_1124199471 -2 Left 1124199466 15:27665949-27665971 CCCGGACTGGCCAAGGAGAGATC No data
Right 1124199471 15:27665970-27665992 TCCCTGCTGGTTTCCAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124199466 Original CRISPR GATCTCTCCTTGGCCAGTCC GGG (reversed) Intergenic
No off target data available for this crispr