ID: 1124200278

View in Genome Browser
Species Human (GRCh38)
Location 15:27673479-27673501
Sequence CACCCTTGACTCTCTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124200274_1124200278 -6 Left 1124200274 15:27673462-27673484 CCTAGGCATAACTAAATCACCCT No data
Right 1124200278 15:27673479-27673501 CACCCTTGACTCTCTCCTGGGGG No data
1124200270_1124200278 11 Left 1124200270 15:27673445-27673467 CCACGCTGCTTCCAGACCCTAGG No data
Right 1124200278 15:27673479-27673501 CACCCTTGACTCTCTCCTGGGGG No data
1124200273_1124200278 -5 Left 1124200273 15:27673461-27673483 CCCTAGGCATAACTAAATCACCC No data
Right 1124200278 15:27673479-27673501 CACCCTTGACTCTCTCCTGGGGG No data
1124200272_1124200278 0 Left 1124200272 15:27673456-27673478 CCAGACCCTAGGCATAACTAAAT No data
Right 1124200278 15:27673479-27673501 CACCCTTGACTCTCTCCTGGGGG No data
1124200269_1124200278 12 Left 1124200269 15:27673444-27673466 CCCACGCTGCTTCCAGACCCTAG No data
Right 1124200278 15:27673479-27673501 CACCCTTGACTCTCTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124200278 Original CRISPR CACCCTTGACTCTCTCCTGG GGG Intergenic
No off target data available for this crispr