ID: 1124200605

View in Genome Browser
Species Human (GRCh38)
Location 15:27675783-27675805
Sequence TTCACACGGTGCTGGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124200605_1124200613 9 Left 1124200605 15:27675783-27675805 CCTCATTCCCAGCACCGTGTGAA No data
Right 1124200613 15:27675815-27675837 TCGTATTCCATGGCTGCTGGAGG No data
1124200605_1124200611 -1 Left 1124200605 15:27675783-27675805 CCTCATTCCCAGCACCGTGTGAA No data
Right 1124200611 15:27675805-27675827 ATGGGAGCAGTCGTATTCCATGG No data
1124200605_1124200612 6 Left 1124200605 15:27675783-27675805 CCTCATTCCCAGCACCGTGTGAA No data
Right 1124200612 15:27675812-27675834 CAGTCGTATTCCATGGCTGCTGG No data
1124200605_1124200617 30 Left 1124200605 15:27675783-27675805 CCTCATTCCCAGCACCGTGTGAA No data
Right 1124200617 15:27675836-27675858 GGCCTGGACTTCTCATGGATAGG No data
1124200605_1124200614 14 Left 1124200605 15:27675783-27675805 CCTCATTCCCAGCACCGTGTGAA No data
Right 1124200614 15:27675820-27675842 TTCCATGGCTGCTGGAGGCCTGG No data
1124200605_1124200616 25 Left 1124200605 15:27675783-27675805 CCTCATTCCCAGCACCGTGTGAA No data
Right 1124200616 15:27675831-27675853 CTGGAGGCCTGGACTTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124200605 Original CRISPR TTCACACGGTGCTGGGAATG AGG (reversed) Intergenic
No off target data available for this crispr