ID: 1124200610

View in Genome Browser
Species Human (GRCh38)
Location 15:27675797-27675819
Sequence TACGACTGCTCCCATTCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124200610_1124200612 -8 Left 1124200610 15:27675797-27675819 CCGTGTGAATGGGAGCAGTCGTA No data
Right 1124200612 15:27675812-27675834 CAGTCGTATTCCATGGCTGCTGG No data
1124200610_1124200616 11 Left 1124200610 15:27675797-27675819 CCGTGTGAATGGGAGCAGTCGTA No data
Right 1124200616 15:27675831-27675853 CTGGAGGCCTGGACTTCTCATGG No data
1124200610_1124200619 27 Left 1124200610 15:27675797-27675819 CCGTGTGAATGGGAGCAGTCGTA No data
Right 1124200619 15:27675847-27675869 CTCATGGATAGGTGTGAAGCAGG No data
1124200610_1124200613 -5 Left 1124200610 15:27675797-27675819 CCGTGTGAATGGGAGCAGTCGTA No data
Right 1124200613 15:27675815-27675837 TCGTATTCCATGGCTGCTGGAGG No data
1124200610_1124200614 0 Left 1124200610 15:27675797-27675819 CCGTGTGAATGGGAGCAGTCGTA No data
Right 1124200614 15:27675820-27675842 TTCCATGGCTGCTGGAGGCCTGG No data
1124200610_1124200620 28 Left 1124200610 15:27675797-27675819 CCGTGTGAATGGGAGCAGTCGTA No data
Right 1124200620 15:27675848-27675870 TCATGGATAGGTGTGAAGCAGGG No data
1124200610_1124200617 16 Left 1124200610 15:27675797-27675819 CCGTGTGAATGGGAGCAGTCGTA No data
Right 1124200617 15:27675836-27675858 GGCCTGGACTTCTCATGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124200610 Original CRISPR TACGACTGCTCCCATTCACA CGG (reversed) Intergenic
No off target data available for this crispr