ID: 1124200611

View in Genome Browser
Species Human (GRCh38)
Location 15:27675805-27675827
Sequence ATGGGAGCAGTCGTATTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124200605_1124200611 -1 Left 1124200605 15:27675783-27675805 CCTCATTCCCAGCACCGTGTGAA No data
Right 1124200611 15:27675805-27675827 ATGGGAGCAGTCGTATTCCATGG No data
1124200603_1124200611 12 Left 1124200603 15:27675770-27675792 CCTGTGCCTCATGCCTCATTCCC No data
Right 1124200611 15:27675805-27675827 ATGGGAGCAGTCGTATTCCATGG No data
1124200602_1124200611 17 Left 1124200602 15:27675765-27675787 CCTGGCCTGTGCCTCATGCCTCA No data
Right 1124200611 15:27675805-27675827 ATGGGAGCAGTCGTATTCCATGG No data
1124200608_1124200611 -8 Left 1124200608 15:27675790-27675812 CCCAGCACCGTGTGAATGGGAGC No data
Right 1124200611 15:27675805-27675827 ATGGGAGCAGTCGTATTCCATGG No data
1124200609_1124200611 -9 Left 1124200609 15:27675791-27675813 CCAGCACCGTGTGAATGGGAGCA No data
Right 1124200611 15:27675805-27675827 ATGGGAGCAGTCGTATTCCATGG No data
1124200601_1124200611 29 Left 1124200601 15:27675753-27675775 CCTCGAGGCTAACCTGGCCTGTG No data
Right 1124200611 15:27675805-27675827 ATGGGAGCAGTCGTATTCCATGG No data
1124200604_1124200611 6 Left 1124200604 15:27675776-27675798 CCTCATGCCTCATTCCCAGCACC No data
Right 1124200611 15:27675805-27675827 ATGGGAGCAGTCGTATTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124200611 Original CRISPR ATGGGAGCAGTCGTATTCCA TGG Intergenic
No off target data available for this crispr