ID: 1124200614

View in Genome Browser
Species Human (GRCh38)
Location 15:27675820-27675842
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124200605_1124200614 14 Left 1124200605 15:27675783-27675805 CCTCATTCCCAGCACCGTGTGAA No data
Right 1124200614 15:27675820-27675842 TTCCATGGCTGCTGGAGGCCTGG No data
1124200608_1124200614 7 Left 1124200608 15:27675790-27675812 CCCAGCACCGTGTGAATGGGAGC No data
Right 1124200614 15:27675820-27675842 TTCCATGGCTGCTGGAGGCCTGG No data
1124200604_1124200614 21 Left 1124200604 15:27675776-27675798 CCTCATGCCTCATTCCCAGCACC No data
Right 1124200614 15:27675820-27675842 TTCCATGGCTGCTGGAGGCCTGG No data
1124200610_1124200614 0 Left 1124200610 15:27675797-27675819 CCGTGTGAATGGGAGCAGTCGTA No data
Right 1124200614 15:27675820-27675842 TTCCATGGCTGCTGGAGGCCTGG No data
1124200603_1124200614 27 Left 1124200603 15:27675770-27675792 CCTGTGCCTCATGCCTCATTCCC No data
Right 1124200614 15:27675820-27675842 TTCCATGGCTGCTGGAGGCCTGG No data
1124200609_1124200614 6 Left 1124200609 15:27675791-27675813 CCAGCACCGTGTGAATGGGAGCA No data
Right 1124200614 15:27675820-27675842 TTCCATGGCTGCTGGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124200614 Original CRISPR TTCCATGGCTGCTGGAGGCC TGG Intergenic
No off target data available for this crispr