ID: 1124200616

View in Genome Browser
Species Human (GRCh38)
Location 15:27675831-27675853
Sequence CTGGAGGCCTGGACTTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124200608_1124200616 18 Left 1124200608 15:27675790-27675812 CCCAGCACCGTGTGAATGGGAGC No data
Right 1124200616 15:27675831-27675853 CTGGAGGCCTGGACTTCTCATGG No data
1124200605_1124200616 25 Left 1124200605 15:27675783-27675805 CCTCATTCCCAGCACCGTGTGAA No data
Right 1124200616 15:27675831-27675853 CTGGAGGCCTGGACTTCTCATGG No data
1124200610_1124200616 11 Left 1124200610 15:27675797-27675819 CCGTGTGAATGGGAGCAGTCGTA No data
Right 1124200616 15:27675831-27675853 CTGGAGGCCTGGACTTCTCATGG No data
1124200609_1124200616 17 Left 1124200609 15:27675791-27675813 CCAGCACCGTGTGAATGGGAGCA No data
Right 1124200616 15:27675831-27675853 CTGGAGGCCTGGACTTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124200616 Original CRISPR CTGGAGGCCTGGACTTCTCA TGG Intergenic
No off target data available for this crispr