ID: 1124200619

View in Genome Browser
Species Human (GRCh38)
Location 15:27675847-27675869
Sequence CTCATGGATAGGTGTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124200615_1124200619 2 Left 1124200615 15:27675822-27675844 CCATGGCTGCTGGAGGCCTGGAC No data
Right 1124200619 15:27675847-27675869 CTCATGGATAGGTGTGAAGCAGG No data
1124200610_1124200619 27 Left 1124200610 15:27675797-27675819 CCGTGTGAATGGGAGCAGTCGTA No data
Right 1124200619 15:27675847-27675869 CTCATGGATAGGTGTGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124200619 Original CRISPR CTCATGGATAGGTGTGAAGC AGG Intergenic
No off target data available for this crispr