ID: 1124200620

View in Genome Browser
Species Human (GRCh38)
Location 15:27675848-27675870
Sequence TCATGGATAGGTGTGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124200610_1124200620 28 Left 1124200610 15:27675797-27675819 CCGTGTGAATGGGAGCAGTCGTA No data
Right 1124200620 15:27675848-27675870 TCATGGATAGGTGTGAAGCAGGG No data
1124200615_1124200620 3 Left 1124200615 15:27675822-27675844 CCATGGCTGCTGGAGGCCTGGAC No data
Right 1124200620 15:27675848-27675870 TCATGGATAGGTGTGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124200620 Original CRISPR TCATGGATAGGTGTGAAGCA GGG Intergenic
No off target data available for this crispr