ID: 1124201127

View in Genome Browser
Species Human (GRCh38)
Location 15:27679320-27679342
Sequence CGGTGTTTTAAGAGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124201120_1124201127 2 Left 1124201120 15:27679295-27679317 CCCTCTCTCTGCGAGGCCAGGTG No data
Right 1124201127 15:27679320-27679342 CGGTGTTTTAAGAGGGTGGCAGG No data
1124201121_1124201127 1 Left 1124201121 15:27679296-27679318 CCTCTCTCTGCGAGGCCAGGTGT No data
Right 1124201127 15:27679320-27679342 CGGTGTTTTAAGAGGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124201127 Original CRISPR CGGTGTTTTAAGAGGGTGGC AGG Intergenic
No off target data available for this crispr