ID: 1124203703

View in Genome Browser
Species Human (GRCh38)
Location 15:27699551-27699573
Sequence TACATGTGGGAGAAAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124203700_1124203703 -10 Left 1124203700 15:27699538-27699560 CCTGGGAAGAACATACATGTGGG No data
Right 1124203703 15:27699551-27699573 TACATGTGGGAGAAAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124203703 Original CRISPR TACATGTGGGAGAAAAGAGG AGG Intergenic
No off target data available for this crispr