ID: 1124207951

View in Genome Browser
Species Human (GRCh38)
Location 15:27739268-27739290
Sequence GGTCAACTCCACCCCTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124207946_1124207951 17 Left 1124207946 15:27739228-27739250 CCTTTAAGGAGAACACTGAAAGA No data
Right 1124207951 15:27739268-27739290 GGTCAACTCCACCCCTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124207951 Original CRISPR GGTCAACTCCACCCCTAGGA AGG Intergenic
No off target data available for this crispr