ID: 1124208088

View in Genome Browser
Species Human (GRCh38)
Location 15:27740359-27740381
Sequence TTGTGTCTGAATTGGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124208088_1124208099 18 Left 1124208088 15:27740359-27740381 CCGTCCTCCCAATTCAGACACAA No data
Right 1124208099 15:27740400-27740422 CAGCCCTGACCATCGCCCCTGGG No data
1124208088_1124208101 21 Left 1124208088 15:27740359-27740381 CCGTCCTCCCAATTCAGACACAA No data
Right 1124208101 15:27740403-27740425 CCCTGACCATCGCCCCTGGGAGG No data
1124208088_1124208105 27 Left 1124208088 15:27740359-27740381 CCGTCCTCCCAATTCAGACACAA No data
Right 1124208105 15:27740409-27740431 CCATCGCCCCTGGGAGGGTCAGG No data
1124208088_1124208103 22 Left 1124208088 15:27740359-27740381 CCGTCCTCCCAATTCAGACACAA No data
Right 1124208103 15:27740404-27740426 CCTGACCATCGCCCCTGGGAGGG No data
1124208088_1124208098 17 Left 1124208088 15:27740359-27740381 CCGTCCTCCCAATTCAGACACAA No data
Right 1124208098 15:27740399-27740421 GCAGCCCTGACCATCGCCCCTGG No data
1124208088_1124208106 28 Left 1124208088 15:27740359-27740381 CCGTCCTCCCAATTCAGACACAA No data
Right 1124208106 15:27740410-27740432 CATCGCCCCTGGGAGGGTCAGGG No data
1124208088_1124208094 -8 Left 1124208088 15:27740359-27740381 CCGTCCTCCCAATTCAGACACAA No data
Right 1124208094 15:27740374-27740396 AGACACAACCCGGGAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124208088 Original CRISPR TTGTGTCTGAATTGGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr