ID: 1124209873

View in Genome Browser
Species Human (GRCh38)
Location 15:27753846-27753868
Sequence CGTCATCCCCTACAATGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124209873_1124209875 2 Left 1124209873 15:27753846-27753868 CCTGAGCATTGTAGGGGATGACG No data
Right 1124209875 15:27753871-27753893 TTAAAGGATGAAAGAGCAGATGG No data
1124209873_1124209878 18 Left 1124209873 15:27753846-27753868 CCTGAGCATTGTAGGGGATGACG No data
Right 1124209878 15:27753887-27753909 CAGATGGGAGCTGAGCTGGAAGG No data
1124209873_1124209876 3 Left 1124209873 15:27753846-27753868 CCTGAGCATTGTAGGGGATGACG No data
Right 1124209876 15:27753872-27753894 TAAAGGATGAAAGAGCAGATGGG No data
1124209873_1124209879 24 Left 1124209873 15:27753846-27753868 CCTGAGCATTGTAGGGGATGACG No data
Right 1124209879 15:27753893-27753915 GGAGCTGAGCTGGAAGGAGCCGG No data
1124209873_1124209877 14 Left 1124209873 15:27753846-27753868 CCTGAGCATTGTAGGGGATGACG No data
Right 1124209877 15:27753883-27753905 AGAGCAGATGGGAGCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124209873 Original CRISPR CGTCATCCCCTACAATGCTC AGG (reversed) Intergenic
No off target data available for this crispr