ID: 1124210488

View in Genome Browser
Species Human (GRCh38)
Location 15:27760190-27760212
Sequence CACATGGAACTGAATGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 837
Summary {0: 1, 1: 0, 2: 2, 3: 68, 4: 766}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124210485_1124210488 9 Left 1124210485 15:27760158-27760180 CCAAGAGATTGTCACAAGGAAAG 0: 1
1: 0
2: 1
3: 21
4: 215
Right 1124210488 15:27760190-27760212 CACATGGAACTGAATGAAAATGG 0: 1
1: 0
2: 2
3: 68
4: 766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124210488 Original CRISPR CACATGGAACTGAATGAAAA TGG Intronic
902687609 1:18089084-18089106 CACAAGGAAGTGCATGAAATGGG + Intergenic
905982288 1:42240653-42240675 CACATGCAAAAGAATGAAACTGG + Intronic
906421343 1:45670619-45670641 CATATGGAAAAGAATGAAATTGG - Intronic
906563596 1:46779131-46779153 CACATGTAAGAGAATGAAACTGG - Intronic
906578648 1:46915358-46915380 CACATGTAAAAGAATGAAACTGG - Intergenic
906903070 1:49858714-49858736 CACTTGAAAATGCATGAAAAAGG + Intronic
906912516 1:49970043-49970065 CACATGCAAAAGAATGAAATTGG + Intronic
907057570 1:51384891-51384913 CACATGCAAATGAATGAAGTTGG + Intronic
907642836 1:56208621-56208643 CACATGCAAAAGAATGAAATTGG + Intergenic
907674095 1:56502894-56502916 CACATGGGAATGCATGCAAAAGG - Intronic
907877875 1:58511714-58511736 CACATGCAAAAGAATGAAACTGG + Intronic
908163474 1:61434899-61434921 CACTTGGAACTGTGGGAAAAGGG + Intronic
908482095 1:64551249-64551271 CACAGAGAACTGAAAGAAGATGG - Intronic
908701188 1:66902739-66902761 CACATGGAAAAGAATGAAGTTGG - Intronic
908771617 1:67601880-67601902 AGCATGGAACTGAAGGGAAAAGG + Intergenic
908871419 1:68617517-68617539 CATATAGAAATGTATGAAAATGG - Intergenic
909486238 1:76177743-76177765 CACAGCGATCTGAATGAAAGAGG - Intronic
909819016 1:80035306-80035328 CACATGTAAAAGAATGAAATTGG - Intergenic
909827957 1:80149618-80149640 CACATGCAGATGAATGAAACTGG - Intergenic
910110735 1:83680305-83680327 CACATGCAAAAGAATGAAATTGG - Intergenic
910180251 1:84474837-84474859 CACATGCAAAAGAATGAAATTGG - Intergenic
910233523 1:85010737-85010759 CACATGTAAAAGAATGAAACTGG + Intronic
911155459 1:94632270-94632292 CACATGGAAAAGAATGAAGTTGG - Intergenic
911204645 1:95080106-95080128 AACATGGAACTGAGTGAAGTGGG - Intergenic
911453083 1:98090673-98090695 CACATGTAAGGGAATGAAGAAGG - Intergenic
911600150 1:99839615-99839637 CACATGCAAAATAATGAAAATGG + Intergenic
911908841 1:103605535-103605557 CACATGCAAAAGAATGAAATTGG + Intergenic
911914076 1:103673926-103673948 CACATGCAAAAGAATGAAATTGG - Intronic
912033022 1:105273814-105273836 CACATGTAAAAGAATGAAACTGG - Intergenic
912275578 1:108254571-108254593 CACATGCAAAAGAATGAAATTGG - Intergenic
912292646 1:108439778-108439800 CACATGCAAAAGAATGAAATTGG + Intronic
913083971 1:115417206-115417228 CACATGCAAATGGATGAAACTGG + Intergenic
913384060 1:118240318-118240340 CACATGTAAAAGAATGAAATTGG + Intergenic
913698871 1:121355126-121355148 CAAATGGGACAGAATTAAAATGG + Intronic
913955551 1:143288004-143288026 CACAGGGAAAAGAAAGAAAAAGG - Intergenic
913981882 1:143527437-143527459 CACAGGGAAAAGAAAGAAAAAGG + Intergenic
914076244 1:144354093-144354115 CACAGGGAAAAGAAAGAAAAAGG + Intergenic
914102934 1:144612403-144612425 CACAGGGAAAAGAAAGAAAAAGG - Intergenic
914138674 1:144924909-144924931 CAAATGGGACAGAATTAAAATGG - Intronic
915036377 1:152929270-152929292 CACATGGAGAAGAATGAAACTGG - Intergenic
915395111 1:155577477-155577499 CTCATGCAAAAGAATGAAAATGG - Intergenic
915662426 1:157415325-157415347 TACATGGAAAGGAATAAAAAGGG - Intergenic
915829143 1:159109353-159109375 CACATGTAAGAGAATGAAACTGG + Intronic
916146917 1:161748352-161748374 CACATGCAAAAGAATGAAGATGG - Intergenic
916964273 1:169919115-169919137 CACATGGAAGGGAATAAGAAAGG + Intergenic
917069316 1:171132469-171132491 CACATGCAAAAGAATGAAATTGG + Intergenic
917365561 1:174228580-174228602 TATATTGAACTGACTGAAAAAGG + Intronic
917420826 1:174862137-174862159 CACATGCAAGAGAATGAAACTGG - Intronic
917424853 1:174902882-174902904 CTCATGGAGACGAATGAAAAAGG - Intronic
917894100 1:179470020-179470042 CACATGCAAAAGAATGAAATTGG - Intronic
918201124 1:182268064-182268086 CACATGCATCTGAATGATTAGGG + Intergenic
918365343 1:183802122-183802144 CACATGTAAAAGAATGAAATTGG - Intronic
918569919 1:185977927-185977949 CTGATGGAACTAACTGAAAAAGG - Exonic
918629314 1:186696882-186696904 CACATCCAAATGAATAAAAAAGG + Intergenic
918735134 1:188051951-188051973 TACTTGGAGATGAATGAAAATGG - Intergenic
918967154 1:191366039-191366061 CACATGGAAAAGAATAAAACTGG - Intergenic
919144051 1:193611043-193611065 CACATGGAAATGTAATAAAAAGG + Intergenic
919306302 1:195843510-195843532 CACATGTAAAAGAATGAAAATGG - Intergenic
919977483 1:202622312-202622334 CACAAGGAACTCAAAGAAATGGG - Intronic
920486280 1:206373824-206373846 CAAATGGGACAGAATTAAAATGG + Intronic
921228780 1:213047693-213047715 TATTTGGAATTGAATGAAAATGG - Intergenic
921757081 1:218870516-218870538 CACATGTAAAAGAATGAAATCGG - Intergenic
922153566 1:223024390-223024412 CACACGGATGTGCATGAAAAAGG - Intergenic
922400954 1:225254979-225255001 CACAGGGAACTAACTGAAAGGGG + Intronic
922520204 1:226243800-226243822 CACATGAAACTCAATAAGAATGG + Intronic
922646902 1:227296310-227296332 CACATGGAAAAGAATGAAGTTGG + Intronic
922743190 1:228027970-228027992 CACATGTAGGTGAATGAAACTGG - Intronic
923100561 1:230811680-230811702 CACATGCAAAAGAATGAAATTGG - Intergenic
923315311 1:232773971-232773993 CACCTGGAACTTACTGAAATGGG - Intergenic
923347509 1:233069682-233069704 TACATTGAACTGAAAGAAAATGG + Intronic
923555047 1:234993793-234993815 GTCATGGAACTCAAGGAAAAGGG + Intergenic
923934080 1:238741683-238741705 CAAAAAGAACTGAAAGAAAAAGG + Intergenic
924505123 1:244675475-244675497 CACATGCAAATGAATGAAGCTGG - Intronic
924546792 1:245035515-245035537 CACATGCAAATGAATGAAGTTGG + Intronic
924906434 1:248458020-248458042 CACATAGAACTGCATGTCAAGGG + Intergenic
924921452 1:248634018-248634040 CACATAGAACTGCATGTCAAGGG - Intergenic
1063082322 10:2780095-2780117 CACAGGGAACAGAGTGTAAAGGG - Intergenic
1063083937 10:2797314-2797336 CACATGCAAATGAATGAAGTTGG + Intergenic
1063400679 10:5742054-5742076 CACATGAAAATCATTGAAAATGG - Intronic
1063758855 10:9048276-9048298 CACATGGAAGTGAGGGAAAAGGG + Intergenic
1063776543 10:9272287-9272309 CACATGCAAAAGAATGAAATTGG - Intergenic
1064376145 10:14797981-14798003 CAGATGTAAAAGAATGAAAATGG + Intergenic
1064508372 10:16061053-16061075 CTCATGGAGAGGAATGAAAATGG - Intergenic
1065051490 10:21797143-21797165 CACATGCAAAAGAATGAAACTGG - Intronic
1065245985 10:23758252-23758274 CACATGCAAAAGAATGAAATTGG - Intronic
1065451289 10:25860729-25860751 CACATGCAAGAGAATGAAATTGG + Intergenic
1065591839 10:27270514-27270536 CACATGCAAAAGAATGAAATTGG - Intergenic
1065658548 10:27980123-27980145 CACATGCAAAAGAATGAAATTGG + Intronic
1066497082 10:35952970-35952992 CAAATGGCACTTAATGAAAAAGG - Intergenic
1066560371 10:36663401-36663423 CACATGTAAAAGAATGAAACTGG + Intergenic
1066624713 10:37394813-37394835 CAGATGGCACTTAATGAAAAAGG - Intergenic
1066651435 10:37659821-37659843 CACATGAAGCCGAATGAAACTGG + Intergenic
1066784477 10:38988078-38988100 CACATGCAGCAGAATGAAACTGG - Intergenic
1067034934 10:42907512-42907534 CATATGAAGCTGAATGAAACTGG + Intergenic
1067168754 10:43886793-43886815 CACATGCAAAAGAATGAAACTGG + Intergenic
1067573655 10:47390490-47390512 CACATGCAAAAGAATGAAATTGG - Intergenic
1068154470 10:53179738-53179760 CAAAGAGTACTGAATGAAAAGGG - Intergenic
1068162011 10:53276843-53276865 CACATGTAAAAGAATGAAACTGG + Intergenic
1068172982 10:53420670-53420692 CACATGTAACTGTATGAATGTGG - Intergenic
1068182766 10:53544057-53544079 CACATGCAAAAGAATGAAATTGG - Intergenic
1068271411 10:54730703-54730725 CATATGTAAAAGAATGAAAATGG + Intronic
1068302694 10:55164769-55164791 CTGATGAAACTGAATCAAAATGG + Intronic
1068370433 10:56106276-56106298 CACATGCAACAGAATGAAACTGG + Intergenic
1068906481 10:62330227-62330249 CACATGAATCTGAGTGAAAGGGG - Intergenic
1069083992 10:64118396-64118418 CACCTGGAACTTATTCAAAATGG + Intergenic
1069919951 10:71810458-71810480 CACATGGAACTAGATGAGAAGGG - Exonic
1070075267 10:73128934-73128956 CACATGCAAAAGAATGAAATCGG - Intronic
1070941076 10:80347649-80347671 CACATGCAAAAGAATGAAACTGG - Intronic
1071582268 10:86783065-86783087 CACATGCAACAGAATGAAGATGG - Intronic
1071891269 10:90010786-90010808 CACATGCAAAAGAATGAAATTGG - Intergenic
1073963054 10:108955722-108955744 CACATGCAAAAGAATGAAACTGG + Intergenic
1073975733 10:109098952-109098974 CACATGGATCAAACTGAAAAAGG + Intergenic
1074174621 10:110985153-110985175 GACATGGAAATAAATGGAAATGG - Intronic
1074486359 10:113886678-113886700 CACATGCAGATGAATGAAATTGG + Intronic
1074612152 10:115032266-115032288 CACATGCAAAAGAATGAAACAGG - Intergenic
1074624595 10:115167090-115167112 CACGTGCAAAGGAATGAAAATGG - Intronic
1074656443 10:115593538-115593560 CACATGGAGAAGAATGAAACTGG + Intronic
1074694224 10:116033148-116033170 TACTTTGAAATGAATGAAAATGG - Intergenic
1075269482 10:121036043-121036065 CACATAGAACTGTATGAACTGGG - Intergenic
1075391346 10:122094811-122094833 CACCTTGATCTGAATGAAACTGG - Intronic
1076081757 10:127588717-127588739 CACACTTAACTGAAAGAAAAAGG + Intergenic
1078121187 11:8510698-8510720 CACATGTAGAAGAATGAAAATGG - Intronic
1078640571 11:13091875-13091897 CACATGAAAGTCACTGAAAAAGG - Intergenic
1079622356 11:22569197-22569219 CATATGCAAAGGAATGAAAATGG + Intergenic
1079650221 11:22919207-22919229 CACATGTAAATGTATGAGAAAGG + Intergenic
1079796343 11:24807671-24807693 AACATGAATCTGAATGAAAATGG - Intronic
1081317892 11:41652523-41652545 CACATGGAGAGGAATGAAACTGG + Intergenic
1081514830 11:43817543-43817565 CACATGTAGCAGAATGAAACTGG - Intronic
1081563930 11:44244582-44244604 TACATGGAACTGAAAACAAAGGG - Exonic
1082222218 11:49653023-49653045 AATATTGAACTGAATGAAAATGG - Intergenic
1082687888 11:56261648-56261670 CACATGTAAAAGAATGAAACTGG + Intergenic
1083424274 11:62575020-62575042 CAGATGGAAATGAAAGGAAACGG + Intronic
1084868356 11:72079068-72079090 CAAATGCCACTAAATGAAAACGG + Intronic
1085793268 11:79514603-79514625 CACATGGAGCTGAAGGACATGGG + Intergenic
1086008567 11:82069769-82069791 CACGTGGAAATAAATGAAACTGG - Intergenic
1086182317 11:83967911-83967933 CACATGCAAAAGAATGAAATTGG - Intronic
1086185219 11:84005294-84005316 CACATGCAAAAGAATGAAACTGG + Intronic
1086265031 11:84987713-84987735 CACATGTAAGAGAATGAAACTGG + Intronic
1086429121 11:86718250-86718272 TACTTTGAACTGAAGGAAAATGG - Intergenic
1086626819 11:88966175-88966197 AATATTGAACTGAATGAAAATGG + Intronic
1086631631 11:89026950-89026972 CACATGGGACAGAAGAAAAAGGG + Intronic
1086749870 11:90478387-90478409 AACATGGAACTTAAGGAAACAGG + Intergenic
1086844805 11:91735378-91735400 CACATGGAAAAGAATGAAACTGG + Intergenic
1087068819 11:94054593-94054615 CACATGCAGCTGAATTGAAAAGG - Intronic
1087092708 11:94290739-94290761 CACATGTAGCAGAATGAAACTGG + Intergenic
1087275636 11:96157984-96158006 CTCCTTGAACTGAATTAAAATGG - Intronic
1087483215 11:98728426-98728448 CACATGTAAAAGAATGAAACTGG + Intergenic
1087622836 11:100562423-100562445 CAGAGGGAACTGCATGAAAAGGG - Intergenic
1087652235 11:100881274-100881296 CACATGTAAGAGAATGAAACTGG - Intronic
1087803156 11:102526045-102526067 CACATAGAACAGACTGAAATGGG + Intronic
1087977439 11:104566645-104566667 AACATAATACTGAATGAAAAAGG - Intergenic
1088064901 11:105705543-105705565 CACATAAAATTGAAGGAAAAAGG + Intronic
1088215950 11:107509694-107509716 CACATGGAAAAGAATGAAGTTGG - Intronic
1088372087 11:109102148-109102170 CACGTGGAGCAGAATGAAACTGG - Intergenic
1088544618 11:110947022-110947044 CACATGGAAGTGACTCTAAATGG + Intergenic
1088556619 11:111067993-111068015 CACATGCAAAAGAATGAAATTGG - Intergenic
1088772774 11:113052484-113052506 CACATGGGACTCAAGGTAAATGG + Intronic
1089168103 11:116493278-116493300 CACATGGCACTCACAGAAAATGG + Intergenic
1089669905 11:120047673-120047695 AGCATTGAAGTGAATGAAAATGG + Intergenic
1089734727 11:120542248-120542270 CACATGCAAAAGAATGAAATTGG + Intronic
1089766207 11:120767744-120767766 CACATGCAAATGAATGAAATTGG - Intronic
1089945425 11:122466811-122466833 CACATGCAAAAGAATGAAACTGG + Intergenic
1090043680 11:123312776-123312798 CACTTGCAAATGAATGAAAATGG + Intergenic
1090105988 11:123854193-123854215 CTCATGGAGAGGAATGAAAAGGG + Intergenic
1090429107 11:126631082-126631104 CACAGACAACTGAATGAAGAGGG - Intronic
1090537924 11:127665576-127665598 AACATGGATCTAAATAAAAAAGG + Intergenic
1090734285 11:129597846-129597868 TACATGGAAATAACTGAAAATGG + Intergenic
1091715410 12:2773041-2773063 CAAATGGAACTGAAGGACAGGGG + Intergenic
1092116139 12:6008883-6008905 CACATGAAAAAGAATGAAATTGG + Intronic
1092316445 12:7420151-7420173 CACATGTAAAAGAGTGAAAACGG + Intronic
1092452992 12:8620451-8620473 CACATGCAAAAGAATGAAATTGG - Intergenic
1092730480 12:11528515-11528537 TACATAGAACTTAATGAAAGTGG - Intergenic
1093219052 12:16397222-16397244 CACATGTAGGAGAATGAAAATGG + Intronic
1093299377 12:17435684-17435706 CACATGTAAAAGAATGAAATTGG + Intergenic
1093944699 12:25094281-25094303 CACATGCAAAAGAATGAAATTGG - Intronic
1094158007 12:27357807-27357829 CACATGGAGAAGAATGAAACTGG + Intronic
1094388598 12:29922736-29922758 CACATGCAAAAGAATGAAACTGG + Intergenic
1095190140 12:39248495-39248517 CACATGCAAAGGAATGAAATTGG - Intergenic
1095377170 12:41543933-41543955 CACATGGACTAGAAAGAAAAAGG + Intronic
1095408895 12:41900511-41900533 CACATGCAAAAGAATGAAATTGG + Intergenic
1095852067 12:46821356-46821378 CACATGCAAAAGAATGAAATTGG - Intronic
1095932487 12:47641645-47641667 CACATGTAAGAGAATGAAACTGG + Intergenic
1096888198 12:54739181-54739203 CACATGTAAGAGAATGAAACTGG - Intergenic
1097699297 12:62803491-62803513 CACATGCAAAAGAATGAAATTGG + Intronic
1097899824 12:64861520-64861542 CACTTAGAACAGAAAGAAAAGGG - Intronic
1097933703 12:65220765-65220787 CACATGCAACAGAATCAAACTGG - Intronic
1098402821 12:70091903-70091925 CATATGCAAATGAATGAAACTGG + Intergenic
1098478050 12:70928436-70928458 CACATTAAATTGAATAAAAAAGG - Intergenic
1098786650 12:74766735-74766757 CACATGCAAAAGAATGAAATAGG + Intergenic
1099687218 12:85905988-85906010 CACATGTAAGAGAATGAAAGTGG - Intergenic
1100421689 12:94440975-94440997 CACATGTAAAAGAATGAAAGTGG + Intronic
1100725873 12:97407978-97408000 AACATGGAACAGAGTGAAGAAGG - Intergenic
1101003638 12:100380732-100380754 AACATTGAGCTGAATGAAGAAGG + Exonic
1101452886 12:104796435-104796457 CATATGGAAATGAATGGACATGG + Intergenic
1101569153 12:105937119-105937141 CAGATGGATCTGAATGCAGAGGG - Intergenic
1103468298 12:121159790-121159812 CACATGGAACTGAGAGACATTGG - Intronic
1103752810 12:123177625-123177647 CCCATACAACTGAATAAAAAGGG + Intronic
1103807949 12:123588846-123588868 CACATGGAACTGATAGAGCAGGG - Intronic
1104172271 12:126293335-126293357 CTCTTGTAACTGAATGAAGATGG + Intergenic
1104331838 12:127854250-127854272 CACATGCAAGTCAATGAAATCGG - Intergenic
1104480331 12:129102013-129102035 TTCATGGAATGGAATGAAAATGG + Intronic
1105479824 13:20764259-20764281 TACACTGAACTGAATGAAAATGG - Intronic
1105788588 13:23774123-23774145 CACATGCAAAAGAATGAAATTGG - Intronic
1106203972 13:27571813-27571835 TACTTGGAACTGAAAGAGAAAGG + Intronic
1106243749 13:27929263-27929285 CACGTGGAAATCATTGAAAATGG + Intergenic
1106278070 13:28234170-28234192 CACATGGAACTGAAAGTAAGAGG - Intronic
1106372606 13:29150734-29150756 CATATGCACCTGAATGAAATTGG - Intronic
1106626940 13:31430361-31430383 CACATGCAGAAGAATGAAAATGG - Intergenic
1106762982 13:32885233-32885255 CAGAATGACCTGAATGAAAATGG + Intergenic
1107076684 13:36328802-36328824 AACAGGAAACTGAATAAAAATGG + Intronic
1107418459 13:40223043-40223065 CAGATGGAAATGAATGCAAAAGG - Intergenic
1107489978 13:40872449-40872471 CTCATGGAAAAGAATGAAAATGG + Intergenic
1107756302 13:43626506-43626528 TATATTGAACTAAATGAAAATGG - Intronic
1107766592 13:43741594-43741616 CTCATGCAACTTAATAAAAAAGG - Intronic
1108007942 13:45971460-45971482 CACATGTAAAAGAATGAAACCGG + Intronic
1108078603 13:46709110-46709132 CACAAGGAAATGAATTTAAAGGG - Intronic
1108943280 13:55986460-55986482 CACATGGTACTGAAAAAAACTGG - Intergenic
1109288136 13:60436469-60436491 CACATGTAGAAGAATGAAAATGG - Intronic
1109341561 13:61067314-61067336 CACATGGAGCTAAAAGAAAAGGG + Intergenic
1109896890 13:68703979-68704001 CACATGCAAGAGAATAAAAATGG + Intergenic
1110122542 13:71901126-71901148 CACAAGAAACTGAATGGAATTGG - Intergenic
1110379542 13:74834673-74834695 CACATGGTAATGAATGAAGTTGG - Intergenic
1110722810 13:78784343-78784365 CACGGGGAACAGAATGTAAAGGG - Intergenic
1111136933 13:84059426-84059448 CACATGGAAGTGAATTGATAAGG - Intergenic
1111259927 13:85724334-85724356 CTCATGGAGATGAATGAAAATGG + Intergenic
1111550288 13:89800641-89800663 CACATGCACAAGAATGAAAATGG - Intergenic
1112068979 13:95827000-95827022 CCAATGGAACGGAATAAAAAGGG + Intronic
1112115717 13:96351034-96351056 AACATGGTTCTCAATGAAAAAGG - Intronic
1112116371 13:96359918-96359940 GACATGGAACTGGAGGAACAAGG + Intronic
1112562427 13:100526292-100526314 CACGTGAAAATGAATCAAAAAGG + Intronic
1113316653 13:109187572-109187594 TATTTTGAACTGAATGAAAATGG - Intronic
1114623947 14:24116234-24116256 CACCTGGAATTGACTGGAAAAGG + Intronic
1114868402 14:26626323-26626345 CACATGGAGAAGAATGAAACTGG + Intergenic
1114947845 14:27708999-27709021 CACATGCAAAATAATGAAAATGG - Intergenic
1115004474 14:28465590-28465612 CATATGGAAAAGAATGAAACTGG - Intergenic
1115031625 14:28802781-28802803 CACTTGCAACTGAATGCAATTGG + Intronic
1115247315 14:31309292-31309314 TATAGGGAACTGACTGAAAAAGG - Intronic
1115385091 14:32788405-32788427 CTCACGGAAAGGAATGAAAAGGG + Intronic
1115691706 14:35850773-35850795 CACATGCAAAAGAATGAAACTGG - Intronic
1116125336 14:40776953-40776975 CACATGTAAAAGAATGAAACTGG - Intergenic
1116420824 14:44730009-44730031 CACATGTAAAAGAATGAAATTGG + Intergenic
1116492616 14:45523933-45523955 CACATGCAAAAGAATGAAACTGG - Intergenic
1116598857 14:46892305-46892327 CACATGCAAAAGAATGAAACTGG + Intronic
1116645600 14:47525060-47525082 CAAATGAAGCTGAATGAAAATGG - Intronic
1116847299 14:49877001-49877023 TACATTGAAATAAATGAAAATGG - Intergenic
1116853591 14:49932160-49932182 CACACTGAACTGAATAAGAAAGG + Intergenic
1116911417 14:50469617-50469639 CAGAGGGAACAGAATGAAAGGGG + Intronic
1117114792 14:52499116-52499138 CACATGCAAAAGAATGAAAATGG + Intronic
1117182628 14:53207481-53207503 CACATGTAGAAGAATGAAAATGG + Intergenic
1117210983 14:53499502-53499524 CACATGGAAAAGAATGAAGTTGG + Intergenic
1117271750 14:54151516-54151538 CACATGTAGCAGAATGAAACTGG + Intergenic
1117533310 14:56680132-56680154 CAGATGGAAGTGACTTAAAAAGG + Intronic
1117934370 14:60885961-60885983 CACATACAAGTGAATGAAACTGG - Intronic
1118111199 14:62721729-62721751 AACATGGCACTAAATGAAAGAGG - Intronic
1118531662 14:66713331-66713353 CACATGTAAGAGAATGAAACTGG - Intronic
1119074672 14:71624213-71624235 CTCATGAAACTGGATGAACAAGG + Exonic
1119106101 14:71925599-71925621 CACATGGAAAAGAATGAAATTGG - Intergenic
1119792182 14:77361281-77361303 CACATGCAAAAGAATGGAAATGG - Intronic
1120423777 14:84321346-84321368 CACATGCAAAAGAATGAAATTGG + Intergenic
1120716731 14:87848564-87848586 CACATGGAAATGAAAGGAAAAGG + Intronic
1120879886 14:89407259-89407281 AACAGGGAAGGGAATGAAAAAGG + Intronic
1121316881 14:92966889-92966911 CACATGCAAAAGAATGAAGATGG + Intronic
1122377446 14:101273646-101273668 CACATGTAGGTGAATGAAACTGG - Intergenic
1122587022 14:102815579-102815601 CACATGTAAAAGAATGAAACTGG - Intronic
1123143032 14:106100013-106100035 CACATGGAAAAGAATAAAACTGG - Intergenic
1124210488 15:27760190-27760212 CACATGGAACTGAATGAAAATGG + Intronic
1124493140 15:30170683-30170705 CACAAGGAACTCAAAGAAATGGG - Intergenic
1124683117 15:31754555-31754577 CACATGTAGGAGAATGAAAATGG - Intronic
1124684742 15:31772353-31772375 CACATAGAGGTGAATGAAAAAGG - Intronic
1124750394 15:32367642-32367664 CACAAGGAACTCAAAGAAATGGG + Intergenic
1124860865 15:33439853-33439875 CATATGTTAATGAATGAAAAAGG - Intronic
1125368038 15:38940181-38940203 AACAAGGAACTGAAAGAAAAAGG - Intergenic
1125425674 15:39546662-39546684 CACATGCAAAAGAATGAAACTGG + Intergenic
1125602777 15:40924628-40924650 CAGAAGGAAATGAAGGAAAAAGG - Intergenic
1126178223 15:45758794-45758816 CACCTGCAAATGAATGAAACTGG - Intergenic
1126418000 15:48438995-48439017 GTGATGGAAGTGAATGAAAAAGG - Intronic
1126794766 15:52251489-52251511 CACATGGAACTGATGAAAACTGG - Exonic
1126928569 15:53620592-53620614 CACATGAAGGTGAATGAAACTGG + Intronic
1126998107 15:54468644-54468666 CACATGCAAAAGAATGAAAATGG - Intronic
1127101693 15:55572347-55572369 CACATGCAGATGAATGAAACTGG + Intronic
1127235918 15:57051838-57051860 CACATGCAAAAGAATGAAATTGG - Intronic
1127525196 15:59786025-59786047 CACATGGAGGAGAATGAAACTGG + Intergenic
1128879389 15:71229125-71229147 CAAATGTGACTGAATGAATAAGG - Intronic
1130328313 15:82899448-82899470 AACAGAGAACTGAAGGAAAAAGG + Intronic
1130843641 15:87724473-87724495 CATAAGGAAATGAATGAAAGGGG + Intergenic
1131344515 15:91633577-91633599 CACACTGAAATGAATGAAGAGGG + Intergenic
1131852346 15:96556570-96556592 CAAATTGGACTGAATGCAAAAGG + Intergenic
1132159490 15:99525391-99525413 AACATGGAAGCTAATGAAAATGG - Intergenic
1133332688 16:4985528-4985550 CACATGCAACAGAATGAAGTTGG - Intronic
1134348156 16:13411046-13411068 CTAATGGAATTGAATGAAAAGGG + Intergenic
1134651692 16:15914436-15914458 CACATGCAAAAGAATGAAATTGG - Intergenic
1134743352 16:16568126-16568148 CACATGCAAAAGAATGAAATAGG + Intergenic
1134797159 16:17051516-17051538 CATATGCAAATGAATGAAACTGG - Intergenic
1134924207 16:18144336-18144358 CACATGCAAAAGAATGAAATAGG - Intergenic
1135245457 16:20852934-20852956 CACATGGACTTAAATGATAAAGG - Intronic
1135645850 16:24161380-24161402 CACATGGAAAAGAATCAGAAGGG + Intronic
1135783309 16:25325425-25325447 CATATGTAACTGAATGAGTATGG + Intergenic
1136280767 16:29209710-29209732 TATTTGGAACTGCATGAAAACGG + Intergenic
1136701232 16:32144786-32144808 CACAGGGAAAAGAAAGAAAAAGG + Intergenic
1136766428 16:32782676-32782698 CACAGGGAAAAGAAAGAAAAAGG - Intergenic
1136770125 16:32830355-32830377 CACAGGGAAAAGAAAGAAAAAGG - Intergenic
1136801670 16:33087702-33087724 CACAGGGAAAAGAAAGAAAAAGG + Intergenic
1136852359 16:33622261-33622283 CACATAGAAAAGAAAGAAAAAGG - Intergenic
1137248505 16:46726025-46726047 CACATGTAAGAGAATGAAACTGG - Intronic
1138082632 16:54105428-54105450 AAGATGGAACGGAGTGAAAAGGG + Intronic
1138176709 16:54906474-54906496 CACATGCAATAGAATGAAACTGG + Intergenic
1139261843 16:65601710-65601732 CACATGGAAATAAATGAGACAGG + Intergenic
1139959275 16:70708414-70708436 CACATGGAACTGCAGGCCAAGGG + Intronic
1140249173 16:73280064-73280086 CACATGCAAAAGAATGAAATTGG + Intergenic
1140566213 16:76045719-76045741 CTAAAGGAACTGAATGGAAAAGG - Intergenic
1141015440 16:80444605-80444627 CAAATGAAACAGTATGAAAAGGG - Intergenic
1141090565 16:81127646-81127668 CACAAGGACCTGAATGAACTTGG + Intergenic
1203068817 16_KI270728v1_random:1044926-1044948 CACAGGGAAAAGAAAGAAAAAGG - Intergenic
1203072544 16_KI270728v1_random:1092462-1092484 CACAGGGAAAAGAAAGAAAAAGG - Intergenic
1203113957 16_KI270728v1_random:1470729-1470751 CACATAGAAAAGAAAGAAAAAGG - Intergenic
1144457051 17:15427444-15427466 CACATGGACCATAATGAAAATGG - Intergenic
1145701506 17:26834225-26834247 CAAATGGAATGGAATCAAAAAGG + Intergenic
1145724528 17:27105881-27105903 CTGATGAAACTGAATCAAAATGG - Intergenic
1145849613 17:28080011-28080033 CACATGGAAAAGAATGAAGTTGG - Intronic
1146238927 17:31196734-31196756 CACATGCAAAAGAATGAAGATGG - Intronic
1146963273 17:37003254-37003276 CACATGCAAAAGAATGAAGATGG + Intronic
1148164863 17:45476376-45476398 CACAAGGGACTGATGGAAAAAGG + Intronic
1149022555 17:51986299-51986321 CACATGTAAGAGAATGAAACTGG + Intronic
1150033096 17:61762194-61762216 CACATGCAGAAGAATGAAAATGG + Intronic
1150362949 17:64553722-64553744 CACATGTAACTGAACGAATACGG - Intronic
1150396081 17:64823039-64823061 CACAAGGAACTGATGAAAAAAGG + Intergenic
1150512558 17:65772053-65772075 TATTTGGAAATGAATGAAAATGG + Intronic
1150604778 17:66681428-66681450 CAGAGAGAACTGAATGAAAGTGG + Intronic
1203194111 17_KI270729v1_random:215929-215951 CGGATGGAAGTGAATGGAAATGG + Intergenic
1203203473 17_KI270730v1_random:15354-15376 CGGATGGAAGTGAATGGAAATGG + Intergenic
1153548006 18:6229672-6229694 CACATGGAAAAGAATGAAATTGG - Intronic
1153754763 18:8269829-8269851 CACATGCAAAAGAATGAAATTGG + Intronic
1155658225 18:28216388-28216410 CACATATTACTGAAGGAAAAAGG + Intergenic
1155766004 18:29633468-29633490 CACATTGGAATGAATGAAATTGG - Intergenic
1155824065 18:30416898-30416920 CTCATGATACAGAATGAAAATGG + Intergenic
1155886576 18:31216096-31216118 CACATGCAAAAGAATAAAAATGG + Intergenic
1156608676 18:38700056-38700078 CACAGGGAAATGAAGGAAACAGG + Intergenic
1156867330 18:41903705-41903727 CATATTGAAATGAATGAGAAAGG + Intergenic
1157933300 18:51846852-51846874 CACATGTAAGAGAATGAAACTGG - Intergenic
1157935615 18:51869191-51869213 CACATGAAGATGAATGAAACTGG - Intergenic
1158338531 18:56439733-56439755 CACATGGAGGAGAATGAAACTGG + Intergenic
1159115992 18:64113967-64113989 CACATAAAAATGAAAGAAAATGG + Intergenic
1159299475 18:66544102-66544124 CACCTGGATCTTAATGAAAGTGG + Exonic
1159540776 18:69772647-69772669 CACATGCAAAAGAATGAAATTGG + Intronic
1159652859 18:70998367-70998389 CATATAGCACTGAATGCAAATGG - Intergenic
1159738115 18:72129503-72129525 CACATGCAAATGAATGATATTGG - Intergenic
1161819644 19:6522003-6522025 CAGATGGAACTGAAGAAAAGAGG - Intergenic
1161899996 19:7111243-7111265 CACATAGAACTGTAAGAAACAGG + Intergenic
1163375315 19:16926814-16926836 AAGATGGAACTGAATGAGATAGG - Intronic
1165637745 19:37357018-37357040 CACATGCAAGAGAATGAAACTGG - Intronic
1167146974 19:47687210-47687232 CATATGTAAATGAATGAACACGG + Intronic
1167240673 19:48341354-48341376 CACATGTAGCAGAATCAAAAGGG + Intronic
1167531538 19:50020687-50020709 CACATAGAAATGAAAGATAATGG + Intronic
925114938 2:1370282-1370304 GACATGGAGCAGAAGGAAAATGG - Intergenic
925598630 2:5585399-5585421 CACATGCAAAAGAATTAAAATGG + Intergenic
926248162 2:11136271-11136293 CACATGCAAAAGAATGAAATTGG - Intronic
927644633 2:24869845-24869867 CACATGGAAAGGAAGGAAAATGG + Intronic
929814008 2:45216625-45216647 CACATGCAAAAGAATGAAATTGG + Intergenic
929868151 2:45735737-45735759 CACATGGGAATGAATGAGGAAGG + Intronic
929963709 2:46517278-46517300 CACATGCAAAAGAATGAAATTGG + Intronic
930402398 2:50906907-50906929 TACTTGGAACTGAAGGAAATTGG + Intronic
930567846 2:53045527-53045549 CACATGCAAAAGAATGAAATTGG - Intergenic
931912433 2:66915384-66915406 CACATTGAACTGGAAGTAAAAGG - Intergenic
931933706 2:67171015-67171037 CAGATAGACCTGATTGAAAAAGG + Intergenic
932062458 2:68520511-68520533 CACATGTAAAAGAATGAAACTGG - Intronic
932182800 2:69664112-69664134 CACATGAAACTGAAAGACAATGG + Intronic
932190429 2:69737130-69737152 CACATGAAACTGAAAGACAATGG - Intronic
932382104 2:71294046-71294068 CACATGCAAAAGAATGAAATTGG - Intronic
932530409 2:72524181-72524203 CACATGGAAGCAAATTAAAATGG - Intronic
932653318 2:73583681-73583703 CACATGCAAAAGAATGAAATTGG - Intronic
933257874 2:80101222-80101244 CAAATGGAAATGCATCAAAATGG - Intronic
933371251 2:81418565-81418587 CACTTGGCACTTAAGGAAAAGGG + Intergenic
933404222 2:81837781-81837803 CACATGCAAATGATTGAAACTGG - Intergenic
933523284 2:83402813-83402835 CACATGTAAGAGAATGAAACTGG + Intergenic
933608748 2:84412119-84412141 CACATGCAAAAGAATGAAATTGG + Intergenic
934810223 2:97270995-97271017 CTCATGGAGAGGAATGAAAAGGG - Intergenic
934827469 2:97436944-97436966 CTCATGGAGAGGAATGAAAAGGG + Intergenic
934892268 2:98080991-98081013 CATGTGGAACTGTGTGAAAATGG - Intergenic
935583508 2:104780276-104780298 CACATGCAACAGAATGAAGTTGG + Intergenic
936969403 2:118162923-118162945 CACATGTAAAAGAATGAAATTGG + Intergenic
937109862 2:119356425-119356447 TACACTGAACTGAATGAAAGTGG + Intronic
937544488 2:123000282-123000304 CAGATCTCACTGAATGAAAAGGG - Intergenic
938223638 2:129595849-129595871 CACATGCAAAAGAATGAAACAGG - Intergenic
938255477 2:129856846-129856868 CACATGCAAAAGAATGAAATTGG + Intergenic
938503374 2:131849556-131849578 CACATGCAAAAGAATGAAATTGG - Intergenic
939252416 2:139698881-139698903 AACAGGGAACTGAGTTAAAAAGG - Intergenic
939533240 2:143391365-143391387 CACATGGACATGAATCAACAAGG - Intronic
940264571 2:151822875-151822897 CAAAAGGAAATGAAGGAAAAGGG - Intronic
940310126 2:152269879-152269901 CACATGCAAAAGAATGAAATTGG + Intergenic
940327774 2:152443412-152443434 CACCTGGGACAGAATGCAAAGGG + Intronic
940542138 2:155034039-155034061 CACATTTAACTGTAAGAAAATGG - Intergenic
942324617 2:174765435-174765457 CACATGGAACTAGGTGAGAAAGG + Intergenic
942433456 2:175942617-175942639 TATTTTGAACTGAATGAAAATGG + Intronic
942669459 2:178358543-178358565 CACATGTAAAAGAATGAAATTGG + Intronic
942861607 2:180619897-180619919 CACATGAAACTGTTAGAAAAAGG + Intergenic
943157686 2:184205052-184205074 CACCTCCAACTGAGTGAAAATGG + Intergenic
943285771 2:185997220-185997242 CACATGCAAAAGAATGAAGATGG + Intergenic
943390385 2:187260018-187260040 CAGATTGAACTAAATAAAAATGG - Intergenic
943431781 2:187811911-187811933 CACATGTAAGAGAATGAAACTGG + Intergenic
943512647 2:188844905-188844927 CACATGCAAAGGAATGAAATTGG + Intergenic
943921888 2:193717934-193717956 TACATGCAAATGAATGAAATTGG + Intergenic
943964466 2:194315035-194315057 CAAAAGAAACAGAATGAAAAGGG - Intergenic
944032183 2:195248399-195248421 CACATGCAAAAGAATGAAACTGG + Intergenic
945149675 2:206776569-206776591 CACATGCAAAAGAATGAAATTGG - Intronic
945548947 2:211195312-211195334 TCTATAGAACTGAATGAAAATGG + Intergenic
946918489 2:224551681-224551703 CAAATGTAAATGAATGAACATGG - Intronic
947071907 2:226297672-226297694 CACATGGGAATAAATGAAATTGG + Intergenic
947784178 2:232800321-232800343 CACATGCAAAAGAATGAAATTGG - Intronic
947911808 2:233805863-233805885 CACATGCAAAAGAATGAAATTGG + Intronic
948882163 2:240864785-240864807 CATAAGGAAATGAATGACAAGGG - Intergenic
948995673 2:241577000-241577022 CAAAGTGAAATGAATGAAAATGG - Intergenic
1169005583 20:2204582-2204604 CAGATGGATGAGAATGAAAAGGG - Intergenic
1169040896 20:2494460-2494482 CACAAGGAACTGAATATAGATGG - Intronic
1169533690 20:6513219-6513241 CACATGTAAAGGAATGAAACTGG + Intergenic
1169573611 20:6933006-6933028 CAAAGGGAATTGAATGAAAAGGG + Intergenic
1170410933 20:16090774-16090796 CACATGCAAAAGAATGAAATTGG + Intergenic
1171130529 20:22648675-22648697 CACATGCAAGAGAATGAAACTGG + Intergenic
1171856800 20:30352489-30352511 TACATGTAACAGAATGAAATCGG - Intergenic
1171919239 20:31084895-31084917 CAAATGGAATAGAATGGAAAGGG + Intergenic
1171927739 20:31203044-31203066 CAAATGGAATAGAATGGAAAGGG + Intergenic
1172049651 20:32107239-32107261 CACATGCAAAAGAATGAAATTGG - Intergenic
1172454822 20:35061656-35061678 CACATGCAAAAGAATGAAACTGG + Intronic
1173196907 20:40922272-40922294 CACATGCAAAAGAATGAAATTGG + Intergenic
1173552721 20:43944470-43944492 CAGAGGGAACAGCATGAAAAAGG + Intronic
1173720033 20:45249585-45249607 AACATGCACCTGAATGATAATGG + Intergenic
1173757464 20:45530235-45530257 CACATGCAAAAGAATGAAATTGG - Intergenic
1174456338 20:50651267-50651289 CACACGGAACTGAATGACCTTGG + Intronic
1174846874 20:53950880-53950902 AACATGTAAATGAATGAACATGG + Intronic
1174896533 20:54455223-54455245 CGCATGGAAATAAATGAAATTGG + Intergenic
1175041624 20:56057559-56057581 GACATGCAAATGTATGAAAATGG + Intergenic
1176525500 21:7864000-7864022 CACATGTAAAAGAATGAAACTGG - Intergenic
1177384400 21:20390043-20390065 CACATGAAAGTTAATGACAATGG - Intergenic
1177503130 21:21984788-21984810 CACATGAAGGTGAATGAAACTGG + Intergenic
1177512241 21:22103424-22103446 CACATGGAGAAGAATGAAACTGG - Intergenic
1177578234 21:22985772-22985794 CACATGTAGTTGAATGAAACTGG + Intergenic
1177671706 21:24239216-24239238 CACAAGAAGCTGAATGAGAATGG + Intergenic
1178218928 21:30633201-30633223 CACATGCAAAAGAATGAAATTGG + Intergenic
1178477338 21:32948738-32948760 CACATGCAAAAGAATGAAATTGG - Intergenic
1178659520 21:34494013-34494035 CACATGTAAAAGAATGAAACTGG - Intergenic
1178909608 21:36664051-36664073 CTCAAGGGACTGAATGAAAGAGG - Intergenic
1180944560 22:19684267-19684289 TACATTGAGCTGAATGAAAATGG + Intergenic
1181146131 22:20848630-20848652 CACATGCAAAAGAATGAAACTGG + Intronic
1181713990 22:24711008-24711030 CGCATGGAAAAGAATGAAGATGG + Intergenic
1182981026 22:34671344-34671366 TACTTTGAACTGAATGATAATGG + Intergenic
1183609370 22:38887889-38887911 CACATGGAAAACAATGAAATTGG + Intergenic
1185129506 22:49030805-49030827 TGCAGGGAACTAAATGAAAAAGG - Intergenic
1185238766 22:49729487-49729509 TATATGGAAATGAATGAATATGG + Intergenic
949352296 3:3136295-3136317 CACATGGAACCTAGTGAGAATGG - Intronic
950439785 3:13003476-13003498 CACAAGGGACTGAGGGAAAATGG + Intronic
950937712 3:16858578-16858600 CATAAGGAAAGGAATGAAAAAGG - Intronic
951254684 3:20434513-20434535 CATAAGTAAGTGAATGAAAAGGG + Intergenic
951733924 3:25842205-25842227 CACATGCAAAGGAATGAAATTGG + Intergenic
952088093 3:29850910-29850932 AAAATGGCAATGAATGAAAAAGG - Intronic
952475799 3:33709311-33709333 CACATGCAAAAGAATGAAATTGG - Intronic
953334068 3:42078995-42079017 CACAAGGAACTGAATTAGACCGG + Intronic
953633194 3:44637658-44637680 CACATGCAAAAGAATGAAGATGG - Intronic
954685064 3:52365778-52365800 CACATGGAATTGAAGCACAATGG - Intronic
954899344 3:54005816-54005838 CAGATGGAACTGTATGCTAATGG + Intergenic
954961475 3:54569249-54569271 CACATTGAAATGAAATAAAATGG - Intronic
955307941 3:57853060-57853082 TAAATGGAATTGAATTAAAAAGG + Intronic
955789083 3:62569732-62569754 AACTTGGAACTGAGTGACAAAGG - Intronic
955859696 3:63314930-63314952 CACATGCAGGAGAATGAAAATGG - Intronic
956904556 3:73752429-73752451 CAGATGGACTTGTATGAAAACGG - Intergenic
957049221 3:75398477-75398499 CACATGGACGTGCATGAAAGTGG + Intergenic
957927250 3:86830064-86830086 TAGATGGGACTGAATAAAAATGG - Intergenic
958022512 3:88015203-88015225 CACATTGCAGTTAATGAAAATGG + Intergenic
958170621 3:89935059-89935081 CATCTGAAACTGAAAGAAAAAGG + Intergenic
958477203 3:94599960-94599982 CACATGTAAGAGAATGAAACTGG + Intergenic
958566479 3:95817845-95817867 TAAATGAAACTGAAAGAAAAAGG + Intergenic
958910839 3:99992861-99992883 CACATGCAAAAGAATGAAACTGG - Intronic
959047220 3:101487657-101487679 CATATGCAACAGAATGAAACTGG - Intronic
959376895 3:105599151-105599173 CACATTGACCTAAAAGAAAAAGG - Intergenic
959865469 3:111264542-111264564 CACATGGAAAAGAATGAAGTAGG + Intronic
959900016 3:111650420-111650442 CACATGGACCAGGATGAAGAGGG + Exonic
960232093 3:115240325-115240347 CAGATGCAACTGAATTGAAAAGG + Intergenic
960329100 3:116336057-116336079 CACATGCAAAAGAATGAAATTGG + Intronic
960391805 3:117085996-117086018 CAGGTGGAAGTGAAAGAAAAAGG - Intronic
960512409 3:118566895-118566917 CACATGTAGGAGAATGAAAATGG - Intergenic
961285852 3:125802366-125802388 CACATGTAAAAGAATAAAAATGG + Intergenic
961915115 3:130366115-130366137 CACATGGAAATAAATGACATTGG - Intronic
961932056 3:130545218-130545240 CACATGCAAAAGAATGAAACTGG - Intergenic
962838516 3:139212055-139212077 CACATGCAAAAGAATGAAATTGG + Intronic
963000380 3:140675601-140675623 CACATGCAACAGAATGAAATTGG + Intergenic
963227589 3:142878008-142878030 CTCCTGGAAATGAATGATAAGGG - Intronic
963996149 3:151711184-151711206 CACATGGAGAAGAATGAAATTGG + Intergenic
964006061 3:151830531-151830553 CACATGGAGAAGAATGAAACTGG + Intergenic
964166236 3:153709126-153709148 CACATGTAAGAGAATGAAACTGG - Intergenic
964225435 3:154394359-154394381 CACATGCAAAAGAATGAAAGTGG + Intronic
964240119 3:154582755-154582777 CACATGGAAAAGAATAAAGATGG + Intergenic
964405309 3:156342522-156342544 CACATTGAACTGGCTGGAAATGG + Intronic
964702588 3:159585434-159585456 CACATGGAACAACATGAAAATGG - Intronic
964915930 3:161841894-161841916 CACATGTAGCAGAATGAAACTGG - Intergenic
965551662 3:169971969-169971991 CACATAGAACTCAATGATAAAGG - Intronic
966369415 3:179232307-179232329 CACATGTAAAAGAATGAAACTGG - Intronic
967198386 3:187049417-187049439 CTCATAGAACTGAAGGGAAAAGG - Intronic
967607852 3:191469320-191469342 GACATGGAACGGAATGAACATGG - Intergenic
967678511 3:192330513-192330535 CACATGCAAAAGAATGAAACTGG + Intronic
968889055 4:3357562-3357584 CACATGCAAAAGAATAAAAATGG - Intronic
969560185 4:7941851-7941873 CACATGGAAGTGAATCAGAGTGG - Intergenic
970062980 4:12056202-12056224 CACATGCAACAGAATGAAATTGG - Intergenic
970146978 4:13046273-13046295 CACATGAAATAGAATGGAAATGG + Intergenic
970154135 4:13124425-13124447 TTCATGCAACTGAATGAATAAGG + Intergenic
970223964 4:13837943-13837965 CACATGCAAAAGAATGAAATTGG + Intergenic
970330127 4:14973583-14973605 TACATTGAACTGAATGAAAATGG - Intergenic
970715027 4:18911941-18911963 CACATGTAAAAGAATGAAATTGG + Intergenic
971048837 4:22837332-22837354 CACAGGGAAAAGAATGAAATTGG + Intergenic
971114996 4:23635200-23635222 CACATGCAAAAGAATGAAACCGG + Intergenic
971447833 4:26770903-26770925 TATTTTGAACTGAATGAAAATGG + Intergenic
971810610 4:31420907-31420929 CAGATGGAAAAGAATGAAATTGG - Intergenic
971993974 4:33939932-33939954 CACATGGAAGTAAATGAAAGAGG + Intergenic
972680658 4:41303892-41303914 CACATGGAAATAAATTAGAACGG + Intergenic
973596301 4:52494002-52494024 CACATGGAGAAGAATGAAACTGG + Intergenic
973977573 4:56278451-56278473 CACATGCAAAAGAATGAAATTGG + Intronic
974296308 4:60003550-60003572 CACATGCAGATGAATGAAACTGG + Intergenic
974660285 4:64879563-64879585 ATCATTGAACTGAATGAGAAAGG - Intergenic
975414479 4:74091421-74091443 AACCTGGAAGTGAAGGAAAATGG - Intergenic
975470993 4:74767832-74767854 CACATGCAAAAGAATGAAATTGG + Intronic
975472817 4:74790531-74790553 CACATGGCAATTACTGAAAATGG - Intronic
975489758 4:74975843-74975865 CTCATGGAGAAGAATGAAAATGG + Intronic
975924956 4:79438831-79438853 CACATGCAAAAGAATGAAATTGG - Intergenic
976395384 4:84549975-84549997 CTCATGGAAAGGAATGAAAAGGG + Intergenic
976428571 4:84935556-84935578 CACATGAAACAATATGAAAATGG - Intronic
976556690 4:86458712-86458734 CACATGTAAGAGAATGAAACTGG + Intronic
977171987 4:93773803-93773825 CAAATAGAACTAAATAAAAAAGG - Exonic
977187165 4:93953976-93953998 CACATGGAAAAGAATGAAATTGG + Intergenic
977360796 4:96001478-96001500 CACAGTGAACTGAATGAGATTGG + Intergenic
977513536 4:97992295-97992317 CACATGTGAATGAATGAAACTGG - Intronic
977763059 4:100762748-100762770 CAAATGCAACTGATTGAAACTGG - Intronic
978001819 4:103564883-103564905 TACATGTTACTGAATGTAAATGG + Intergenic
978338839 4:107699537-107699559 CACATGGAAAAAAACGAAAATGG + Intronic
978549232 4:109906940-109906962 CACATGCAAAAGAATGAAACTGG + Intergenic
978679111 4:111356764-111356786 CTCATGGAACTCAGTGACAACGG - Intergenic
978905648 4:114002318-114002340 CAAATGGAAATGAAGGAAGAAGG - Intergenic
979439725 4:120736962-120736984 GGGATGGAAATGAATGAAAATGG - Intronic
979506111 4:121499157-121499179 CACATGCAAAAGAATGAAATTGG - Intergenic
979982007 4:127268336-127268358 CACATGCAAAACAATGAAAATGG + Intergenic
980005527 4:127538060-127538082 CACATGCAAAAGAATGAAATTGG + Intergenic
980089349 4:128425944-128425966 TACATGGAGCTGGATGAAAGAGG + Intergenic
980258796 4:130420341-130420363 CTGAAGGAAATGAATGAAAATGG + Intergenic
981575435 4:146199285-146199307 CACATGCAAAAGAATGAAAATGG - Intronic
981618940 4:146671975-146671997 CACAAGGAACTGAAAGAATATGG - Intergenic
981628189 4:146785698-146785720 AACATGTAAAAGAATGAAAAGGG - Intronic
982757024 4:159233350-159233372 CACATGAAAAAGAATGAAATTGG - Intronic
982916041 4:161210670-161210692 CACATGCAAAAGAATGAAATTGG - Intergenic
982956359 4:161773139-161773161 CACATGGAGAAGAATGAAACTGG + Intronic
983308516 4:166025032-166025054 TCCTTGGAAATGAATGAAAAAGG + Intronic
983395586 4:167190809-167190831 CAAATGAAACAGAATGAAATTGG - Intronic
984149247 4:176106422-176106444 CACATGCAAAAGAATGAAATTGG + Intronic
984687081 4:182681387-182681409 CACATTGAAGTGAATTAAGAAGG + Intronic
985349158 4:189039202-189039224 TACAAGGCACTGAAAGAAAATGG + Intergenic
985388706 4:189471969-189471991 CACATGCAAATGAATAAAACTGG - Intergenic
985565964 5:617516-617538 CTCATGTTACTGAAAGAAAAGGG - Intronic
987829236 5:23074540-23074562 CACATGGACCTGAGTGAAACAGG - Intergenic
988140281 5:27230230-27230252 CACATGAAACTTCCTGAAAAGGG + Intergenic
990918296 5:60934760-60934782 CACATGGAGGAAAATGAAAATGG - Intronic
991042647 5:62191960-62191982 CACATGCAAAAGAATGAAATTGG - Intergenic
991418868 5:66420177-66420199 CACATGTAAAAGAATGAAACTGG - Intergenic
991516794 5:67445121-67445143 CACATGCAAAAGAATGAAACTGG - Intergenic
993271641 5:85804899-85804921 CAAATGTAACTGAATGGAAAGGG + Intergenic
993324577 5:86517126-86517148 AAAAAGGAAATGAATGAAAATGG - Intergenic
993529519 5:89006718-89006740 CACATGCAAAAGAATGAAATTGG - Intergenic
993801188 5:92339934-92339956 CACATGCAAAAGAATGAAATTGG - Intergenic
994338437 5:98597577-98597599 CATTTGGAACTGAATAAAACAGG + Intergenic
994563483 5:101409076-101409098 CACATGTAAAAGAATGAAACTGG + Intergenic
994611879 5:102052324-102052346 CACATGGAAATGGAAAAAAATGG - Intergenic
995149318 5:108823973-108823995 CACATGTAAGAGAATGAAACTGG - Intronic
995375275 5:111467131-111467153 CACATGTATATGAATGAAACTGG + Intronic
995566815 5:113439426-113439448 CACAGAGAAATGAATGAATATGG + Intronic
995974444 5:118015228-118015250 CACATGCAAAAGAATGAAATTGG - Intergenic
996028155 5:118674291-118674313 CACATGTAAGAGAATGAAATTGG - Intergenic
996121183 5:119674038-119674060 CACATGCAAATGAATGAAGTTGG - Intergenic
996160529 5:120156580-120156602 CACATGCAAAAGAATGAAATTGG + Intergenic
996209641 5:120791703-120791725 AAAATGGAACTCAATCAAAAAGG + Intergenic
996390651 5:122957212-122957234 CACATGCAAAAGAATGAAACTGG - Intronic
996487203 5:124050537-124050559 TACATGGAACTAAATGAAAACGG - Intergenic
996490930 5:124095291-124095313 CACATGTAAAAGAATGAAACTGG - Intergenic
996668245 5:126085960-126085982 CACATGCAAAAGAATGAAATTGG + Intergenic
997151216 5:131497549-131497571 CATATGCAAAAGAATGAAAATGG - Intronic
997719767 5:136068685-136068707 CACATGGAAAAGAATGAAGTTGG - Intergenic
998634948 5:143943051-143943073 CACATGTAAGAGAATGAAACTGG - Intergenic
998659521 5:144220639-144220661 CTTATAGAAATGAATGAAAAGGG + Intronic
999500878 5:152145319-152145341 CACTTGGAAGTAAAGGAAAAAGG - Intergenic
999516504 5:152307222-152307244 CACAGGGAACAGAAGAAAAAAGG + Intergenic
1000615968 5:163427074-163427096 CACATGTAAGAGAATGAAACTGG + Intergenic
1000808036 5:165821978-165822000 CACATGCAAATGAATAAAATTGG - Intergenic
1001509233 5:172307141-172307163 CACATGAAAAAGAATGAAATTGG + Intergenic
1001917316 5:175572405-175572427 CACATGGAAAAGAATGAAGTTGG + Intergenic
1002323651 5:178390727-178390749 CACATGCAAAAGAATGAAAGTGG + Intronic
1002495247 5:179607276-179607298 CAAAGGGAACTGATTGAAAGTGG + Intronic
1003233908 6:4279257-4279279 CACATGGAAAAGAATGAAGTTGG - Intergenic
1003256698 6:4481471-4481493 CACATGCAAAAGAATGAAATTGG + Intergenic
1003688948 6:8333148-8333170 CACAAGCAACTCAAGGAAAATGG - Intergenic
1003892514 6:10576038-10576060 CACACGGACGTGCATGAAAACGG + Intronic
1004451711 6:15753827-15753849 CACCTGGCACTGAAGGAAGATGG - Intergenic
1004552766 6:16665446-16665468 CACATGGAAGAGAATGGGAATGG + Intronic
1004593030 6:17071907-17071929 CACATGTAAGAGAATGAAACTGG - Intergenic
1004792918 6:19048572-19048594 TACTTTGAACTAAATGAAAATGG - Intergenic
1005255175 6:23994758-23994780 CACATGGAGAAGAATGAAACTGG + Intergenic
1005255286 6:23996104-23996126 CACATGGAGAAGAATGAAACTGG + Intergenic
1005370129 6:25123653-25123675 GACATGGAGCTGGAGGAAAAAGG + Intergenic
1005699151 6:28382683-28382705 AACAAGGCACTGAAAGAAAACGG + Intronic
1006273362 6:32981199-32981221 CAAATGGAGCGGAAGGAAAAAGG - Exonic
1006659502 6:35628179-35628201 CACATGTAAAAGAATGAAATTGG - Intronic
1007026208 6:38577348-38577370 CACATGTGAATGAATGAGAAGGG - Intronic
1007121003 6:39381358-39381380 CAAAGGGAACAGAATGAAAAGGG + Intronic
1007326836 6:41068562-41068584 CAAATGTAGCTGAATGACAATGG + Intronic
1008238534 6:49078807-49078829 CACATGCAAAGGAATGAAACTGG - Intergenic
1008973163 6:57393858-57393880 CACATGTAAGAGAATGAAACTGG - Intronic
1009162069 6:60295397-60295419 CACATGTAAGAGAATGAAACTGG - Intergenic
1009658160 6:66572801-66572823 CACATGCAAAGGAATGAAATTGG - Intergenic
1009764090 6:68046651-68046673 CACATGCAAAAGAATGAAATTGG + Intergenic
1009788251 6:68366143-68366165 CACATGGAAAAGAACGAAACTGG - Intergenic
1010118689 6:72346808-72346830 AACATGTAAATGAATGAAGATGG - Intronic
1010153742 6:72767282-72767304 CACATGAAAAAGAATGAAATTGG + Intronic
1010274581 6:73954542-73954564 CACATGTAAAAGAATGAAACTGG - Intergenic
1010471955 6:76239072-76239094 CACATGCAAAAGAATGAAATTGG + Intergenic
1010480062 6:76340299-76340321 CACATGCAATAGAATGAAATTGG + Intergenic
1010632277 6:78212382-78212404 CACATGCAAAAGAATGAAACTGG - Intergenic
1011079801 6:83477075-83477097 CATATGGAACTGTGAGAAAATGG + Intergenic
1011832389 6:91389068-91389090 CACATGTAAAAGAATGAAACTGG + Intergenic
1012156296 6:95823731-95823753 CACATGTAAGAGAATGAAACTGG + Intergenic
1012348866 6:98226275-98226297 CAAATGTTACTGAATGTAAAAGG - Intergenic
1012724679 6:102795497-102795519 CACATGTAAGAGAATGAAACTGG - Intergenic
1012813201 6:103986981-103987003 ACCAGGGAACTGAAAGAAAATGG - Intergenic
1013044073 6:106466510-106466532 AAAATGGAAGGGAATGAAAAGGG + Intergenic
1013748301 6:113371526-113371548 GAATTGGAAATGAATGAAAATGG + Intergenic
1014334251 6:120112371-120112393 CACATGCAAATGAAGGAAATTGG + Intergenic
1015204748 6:130623347-130623369 CACATGCAAAAGAATGAAATTGG - Intergenic
1015249290 6:131109989-131110011 CATATTGACCTGAATGAAACAGG - Intergenic
1015688331 6:135891649-135891671 CACACCCAAATGAATGAAAATGG - Intronic
1015703351 6:136060082-136060104 CACATATATCAGAATGAAAATGG + Intronic
1015805701 6:137106379-137106401 CAAATGGAAATGAATGAAATTGG - Intergenic
1016205325 6:141460664-141460686 CACATGGAAGCGCATGAAACTGG + Intergenic
1016837136 6:148489165-148489187 CACATGCAAATGAATGAAGTTGG - Intronic
1017272397 6:152523250-152523272 CACATGTAAAAGAATGAAACTGG - Intronic
1017706106 6:157124223-157124245 CAAATGGGTCTGAATGAAGATGG + Intronic
1018423219 6:163657950-163657972 AACTTTGAAATGAATGAAAATGG + Intergenic
1018540243 6:164871945-164871967 CAGATATAAGTGAATGAAAAAGG - Intergenic
1018555118 6:165041271-165041293 CACATGCAAAAGAATGAAATTGG - Intergenic
1018591328 6:165426421-165426443 TACATGGAAAAGAATGAAACTGG + Intronic
1019096599 6:169586416-169586438 CACATGGAACCCTATGGAAAGGG - Intronic
1019561121 7:1658207-1658229 CACATGCAAGAGAATGAAGATGG + Intergenic
1019673450 7:2295779-2295801 CACATGCAAAAGAATGAAACTGG - Intronic
1019819013 7:3226220-3226242 CACATGTAGAAGAATGAAAATGG + Intergenic
1020577519 7:9952651-9952673 CACATGCAAAAGAATGAAATTGG - Intergenic
1020635298 7:10689484-10689506 CACATGTAGGAGAATGAAAATGG + Intergenic
1021356956 7:19661328-19661350 TACTTGGAAATAAATGAAAATGG + Intergenic
1021372379 7:19864877-19864899 CAGTTGGAACCAAATGAAAATGG + Intergenic
1021382706 7:19987079-19987101 CACATGCAAAAGAATGAAACTGG - Intergenic
1022574814 7:31487368-31487390 GACATGGAAATGCAAGAAAATGG - Intergenic
1023893397 7:44411088-44411110 CACATGCAAAAGAATGAAACTGG + Intronic
1024375356 7:48631349-48631371 CACATGCAAAAGAATGAAACTGG - Intronic
1024490156 7:49973021-49973043 CACATGCAAATGAATGAAGTTGG + Intronic
1024652813 7:51420923-51420945 CACATGCAAAAGGATGAAAATGG - Intergenic
1024744946 7:52395324-52395346 CACATGTAGCAGAATGAAACTGG - Intergenic
1024782676 7:52869893-52869915 CACATGTAGCAGAATGAAACCGG + Intergenic
1025269093 7:57492287-57492309 CACATGGAATGGAATGGAATGGG + Intergenic
1025480211 7:60973534-60973556 CACAGGGAAAAGAAAGAAAAAGG + Intergenic
1025565115 7:62424860-62424882 CACAGGGAAAAGAAAGAAAAAGG + Intergenic
1027328565 7:77066900-77066922 CACATGTAAGAGAATGAAACTGG - Intergenic
1027429954 7:78101496-78101518 CACATGCAAAAGAATGAAATTGG + Intronic
1027502248 7:78967645-78967667 CACATGCAAAAGAATGAAATTGG - Intronic
1027580078 7:79981807-79981829 TACATCAAACTGAATGAAATAGG + Intergenic
1027650580 7:80862887-80862909 CACATGGAGGAGAATGAAACTGG + Intronic
1027986889 7:85304464-85304486 CCCAGGCAACTGAAGGAAAAAGG + Intergenic
1028510232 7:91617429-91617451 CACATGGACCAAAGTGAAAATGG - Intergenic
1029000139 7:97144510-97144532 CACATGTAAGAGAATGAAACTGG - Intronic
1030019131 7:105255471-105255493 CAGATGGAAAAGAAGGAAAAGGG + Intronic
1030171868 7:106610696-106610718 GACATGTAACTGAAGAAAAATGG - Intergenic
1030185374 7:106756632-106756654 CACATGCAAAAGAATGAAACTGG - Intergenic
1030390045 7:108916538-108916560 CACATGTAAGAGAATGAAACTGG - Intergenic
1030480701 7:110100271-110100293 CACATGTAAAAGAATGAAACTGG + Intergenic
1030880865 7:114877381-114877403 CACATGCAACCAAAGGAAAATGG - Intergenic
1030901268 7:115127529-115127551 CACCTAGAACAGAATGAAAAAGG + Intergenic
1031590303 7:123582593-123582615 CACATAGATCTGAGGGAAAATGG - Intronic
1031637345 7:124117867-124117889 CACATGGAGAAGAATGAAACTGG + Intergenic
1031724854 7:125225637-125225659 ATGATGGACCTGAATGAAAACGG - Intergenic
1031835495 7:126676668-126676690 CACATGTAAAAGAATGAAACTGG + Intronic
1031879625 7:127181788-127181810 CACATGGAGGAGAATGAAACTGG + Intronic
1032290446 7:130585261-130585283 CACATGTAGCAGAATGAAACTGG + Intronic
1033081022 7:138297230-138297252 CACATGCAAAAGAATGAAAATGG - Intergenic
1033083654 7:138321821-138321843 CACATGCAAAAGAATGAAATTGG + Intergenic
1033490969 7:141843229-141843251 CATTTGGAACTGAAAAAAAATGG + Intergenic
1033507705 7:142022146-142022168 CAAATGGGACTGAATGAATGGGG + Intronic
1033945372 7:146710027-146710049 TGCAAGGATCTGAATGAAAAGGG + Intronic
1034031179 7:147765828-147765850 AACATGGAAATGAATAAACAAGG + Intronic
1034103976 7:148474942-148474964 CAATTGGGACTGAATGAAAGAGG + Intergenic
1034300471 7:150010817-150010839 CAGATGGAACAGAATGAGAAAGG + Intergenic
1034402362 7:150871335-150871357 CACATGTAAAAGAATGAAACCGG + Intergenic
1034645950 7:152647593-152647615 CATATGGAAAAGATTGAAAATGG - Exonic
1034805583 7:154086491-154086513 CAGATGGAACAGAATGAGAAAGG - Intronic
1034891660 7:154844958-154844980 CCCTTGGAACTTAGTGAAAAGGG + Intronic
1035052526 7:156008113-156008135 CACATGCAAAAGAATGAAATTGG - Intergenic
1035942744 8:3921589-3921611 TAGATGGAAATAAATGAAAATGG - Intronic
1036730899 8:11263761-11263783 TACTTTGAACTGAATTAAAATGG - Intergenic
1037601373 8:20397873-20397895 CACATGCAAAAGAATGAAATTGG - Intergenic
1037939103 8:22938074-22938096 CAAATTGAACTCCATGAAAATGG + Intronic
1038043385 8:23745942-23745964 CACATGTAATTGAATGGAATGGG - Intergenic
1038442441 8:27581305-27581327 CACATGCAAAAGAATGAAATTGG - Intergenic
1038730468 8:30122260-30122282 CACATGCAAAGGAATGAAATTGG + Intronic
1038853621 8:31306310-31306332 CACATGCCAAAGAATGAAAATGG - Intergenic
1038989333 8:32849073-32849095 CACATGCAAAAGAATGAAATTGG - Intergenic
1039122406 8:34161876-34161898 CACATGGTACAAAATGAAAAAGG - Intergenic
1039155271 8:34548594-34548616 CACATGCAATTAAATGAAATTGG - Intergenic
1039637205 8:39179832-39179854 CTCATGGAAAGGAATGAAAACGG - Intronic
1039783380 8:40810518-40810540 CACATGGAAGAAAATCAAAATGG + Intronic
1040004336 8:42606085-42606107 CACATGGAATAGAATTAAATTGG - Intergenic
1040413565 8:47178903-47178925 CATATGCAACAGAATGAAATAGG + Intergenic
1040461256 8:47650897-47650919 CACATGGAGAGGAATGAAACTGG + Intronic
1040662352 8:49588963-49588985 CACATGCAAATGAATGAAGTTGG + Intergenic
1040809752 8:51438868-51438890 CACATGGAGAAGAATGAAACTGG + Intronic
1040821276 8:51560601-51560623 CACATGGAAAAGAATAAAACTGG + Intronic
1040857404 8:51962076-51962098 CTCCTGTAACTGAATGAGAAAGG + Intergenic
1040898989 8:52397644-52397666 CACATGCAAATGAATAAAACTGG - Intronic
1041845799 8:62327512-62327534 CACATGGTAATGAATGAATCTGG - Intronic
1041864700 8:62558104-62558126 CACATGGAAGAGAATGAAACTGG - Intronic
1042007665 8:64200057-64200079 TATGTGGAAATGAATGAAAAAGG - Intergenic
1042897226 8:73684404-73684426 CACATGGAGAAGAATGAAACTGG + Intronic
1043129602 8:76444705-76444727 CAGAAGGTACAGAATGAAAAGGG + Intergenic
1043176674 8:77030100-77030122 CACAGGGAACTGAAGAAAATGGG - Intergenic
1043230145 8:77789911-77789933 CACGTGGAAAGGAATGAAAGAGG - Intergenic
1043875976 8:85486730-85486752 CACATGTAAAAGAATGAAATGGG - Intergenic
1044022477 8:87122755-87122777 CACATGCAAAGGAATGAAATTGG - Intronic
1044498449 8:92920726-92920748 CACATGCAACTGAGTAGAAATGG + Intronic
1045804128 8:106137202-106137224 AACATGGAACTGAAGGCAATTGG - Intergenic
1045894552 8:107198951-107198973 CACATGTAAAAGAATGAAATTGG - Intergenic
1046436842 8:114201671-114201693 CACATCAAATTGATTGAAAAGGG + Intergenic
1046478095 8:114775964-114775986 CACTTTGAACTGAATGACAATGG + Intergenic
1046806301 8:118482373-118482395 CAAATGGAAAGGAAGGAAAATGG + Intronic
1047524921 8:125624824-125624846 CACAGAGAACTGAATTCAAAAGG - Intergenic
1047635194 8:126754123-126754145 GACAGAGAACTGAATGAAAAAGG + Intergenic
1049016236 8:139921990-139922012 CACATGGAAATAAATGTCAAAGG + Intronic
1049103171 8:140593956-140593978 CAGATGGAACTGAGTGAACCTGG - Intronic
1050400686 9:5250199-5250221 CACATGTAGATGAATGAAACTGG + Intergenic
1051113670 9:13669487-13669509 CACATGCAAATGAATAAAATTGG + Intergenic
1051245575 9:15107653-15107675 CACATGCAAAAGAATAAAAATGG + Intergenic
1051319477 9:15886070-15886092 CACATGCAAAAGAATGAAATTGG + Intronic
1051612747 9:18977649-18977671 CACTTGGAATTGTATGAAAATGG + Intronic
1051945284 9:22562032-22562054 CACAGGGAAGAGAATGAAATTGG + Intergenic
1052247510 9:26354255-26354277 CACATGCAAAAGAATGAAATGGG + Intergenic
1052305333 9:27002282-27002304 CACATGGACCCGCATGAAAGTGG - Intronic
1052435435 9:28421950-28421972 CACATGCAACAGAATGAAGATGG + Intronic
1052482858 9:29054306-29054328 CAAATGGAACTGAATTACAGTGG + Intergenic
1052564964 9:30137947-30137969 CACATGTAAAAGAATGAAATTGG + Intergenic
1053413526 9:37931059-37931081 CACATGCAAAAGAATGAAACTGG + Intronic
1055160668 9:73122743-73122765 CAGAAGGAACTGAATTAGAAAGG + Intergenic
1055242386 9:74198921-74198943 TACCTGGAACTGAATAAAAGGGG - Intergenic
1055346359 9:75343848-75343870 TACATGGAACTACATGGAAACGG - Intergenic
1055388711 9:75794973-75794995 CACAACTAACTGGATGAAAAAGG - Intergenic
1055555959 9:77473951-77473973 CACATGCAAAAGAATGAAACTGG + Intronic
1055666611 9:78559487-78559509 CTCATGGAACTTAATCTAAATGG - Intergenic
1055727802 9:79250280-79250302 AACAAGGAACAGAATGATAATGG + Intergenic
1055782661 9:79836174-79836196 CACATGGTAAGGATTGAAAATGG + Intergenic
1056095541 9:83250034-83250056 CTCATGGAGATGAATAAAAAGGG + Intronic
1056596194 9:88009690-88009712 CACATGCAACAGAATGAAGCTGG + Intergenic
1057511419 9:95682571-95682593 TACATGCAAAAGAATGAAAATGG + Intergenic
1057585275 9:96323302-96323324 CACATGCACATGAATGAATAGGG - Intronic
1057609635 9:96529272-96529294 CACATGTAAAAGAATGAAATTGG - Intronic
1057784680 9:98077949-98077971 CAAAAGGAACTGAATTAAAGAGG - Intronic
1058143964 9:101389643-101389665 CAGATGGTTCTGAATGACAAAGG - Exonic
1058200910 9:102039239-102039261 CACATTTAACTGAATCCAAACGG + Intergenic
1058771160 9:108233458-108233480 CACATGTAAGAGAATGAAACCGG + Intergenic
1059257209 9:112941660-112941682 CACATTGAACTGTATTAAAGTGG - Intergenic
1059397360 9:114045413-114045435 CACATGTAAAAGAATGAAATTGG - Intronic
1060222738 9:121773205-121773227 CAGATGTCACTGACTGAAAAAGG + Exonic
1061154517 9:128849491-128849513 CACATGTAAATGAATGAATTTGG + Intronic
1061525222 9:131155675-131155697 CACATGTAAAAGAATGAAACTGG - Intronic
1062225145 9:135446236-135446258 AAAATGGAAATGACTGAAAATGG - Intergenic
1062369305 9:136229254-136229276 CACATGGAACTGAGGAAGAAGGG + Intronic
1062724838 9:138066125-138066147 TACATGGAATTGATTGAAACTGG - Intronic
1203726728 Un_GL000216v2:55841-55863 CAAATGGAATGGAATGGAAAGGG - Intergenic
1203344889 Un_KI270442v1:26860-26882 GGAATGGAACTGAATGGAAATGG + Intergenic
1186030406 X:5362797-5362819 CACAGGGAACTGAATATGAAGGG - Intergenic
1186618251 X:11212586-11212608 CACATGGAACTCAATTAGACTGG - Intronic
1186768928 X:12798364-12798386 GTGATGGAACTGAATGGAAATGG + Intronic
1186964562 X:14773085-14773107 CTCATGGAGAGGAATGAAAACGG - Intergenic
1187119429 X:16389649-16389671 CACATGCAAAAGAATGAAATTGG + Intergenic
1187226945 X:17382538-17382560 AACATGGATCTAAATGACAAAGG - Intronic
1188125860 X:26368001-26368023 CACATGCAAAAGAATGAAATTGG - Intergenic
1188428391 X:30076058-30076080 CAGTTGGAACTGAACCAAAAAGG - Intergenic
1188889965 X:35597689-35597711 CACATGTAAATGAATGAAACTGG + Intergenic
1189191229 X:39108309-39108331 CACATGCAAAAGAATGAAACTGG - Intergenic
1190500541 X:51072915-51072937 CACATGTAAAAGAATGAAATTGG + Intergenic
1190513433 X:51196999-51197021 CACATGTAAAAGAATGAAATTGG - Intergenic
1190555877 X:51635168-51635190 CACATGCAAAAGAATGAAATTGG - Intergenic
1191727068 X:64292721-64292743 ACCCAGGAACTGAATGAAAAAGG + Intronic
1191806628 X:65142696-65142718 CACATGTAAGAGAATGAAACTGG - Intergenic
1192351331 X:70359204-70359226 CACATGAAAATGAACAAAAAAGG - Intronic
1192387275 X:70683998-70684020 CACATGCAAATGAATGAAATTGG + Intronic
1192622363 X:72691104-72691126 CACATGCAAAAGAATGAAATTGG - Intronic
1192864038 X:75110947-75110969 CACATGTAAATGAATAAAAAGGG + Intronic
1192865160 X:75123226-75123248 CACATGCAAAAGAATGAAACTGG - Intronic
1193174884 X:78381210-78381232 CACATGTAGAAGAATGAAAATGG - Intergenic
1193181336 X:78460936-78460958 CACATGCAGAAGAATGAAAATGG - Intergenic
1193208295 X:78775092-78775114 CACATGTAGGTGAATGAAACTGG - Intergenic
1193315494 X:80060331-80060353 CATATGCAAAAGAATGAAAATGG - Intergenic
1193429077 X:81378005-81378027 CACATGGCACAGCATGATAAAGG - Intergenic
1193762989 X:85489716-85489738 CTCATGGAAAGGAATGAAAGGGG - Intergenic
1193982337 X:88198137-88198159 CACATGTAGAAGAATGAAAATGG + Intergenic
1194028058 X:88778602-88778624 CACATGTAAAAGAATGAAACCGG - Intergenic
1194113010 X:89859693-89859715 CACATGCAAATGAATAAAATGGG - Intergenic
1194280189 X:91941974-91941996 CATTTTGAACTGAATGGAAATGG + Intronic
1194314749 X:92362830-92362852 CACATGCAAATGAATGAAGGTGG - Intronic
1194837866 X:98703552-98703574 CACATGGAGAAGAATAAAAACGG - Intergenic
1194887195 X:99331243-99331265 CACTGGGAAATGAATGTAAATGG + Intergenic
1195331338 X:103804193-103804215 CACATGGAAAACAATGAAATTGG - Intergenic
1195483850 X:105379792-105379814 CACATAGAACTTACTCAAAAAGG + Intronic
1195999443 X:110765498-110765520 CACATGTAAGAGAATGAAACTGG - Intronic
1196204848 X:112927786-112927808 CACATGTAAGAGAATGAAACTGG + Intergenic
1196239311 X:113323000-113323022 CACATGCAAAAGAATGAAATTGG + Intergenic
1196259089 X:113556573-113556595 CCCATGGAAATGAATGACACCGG + Intergenic
1196730118 X:118932744-118932766 CATATTTAACTGAATGAAAATGG - Intergenic
1196822994 X:119718306-119718328 CACATGCAAAAGAATGAAACAGG + Intergenic
1196985777 X:121268855-121268877 CACATGCAAAAGAATGAAATTGG - Intergenic
1197132854 X:123024930-123024952 CACATGTAAAAGAATGAAACTGG + Intergenic
1197180779 X:123533761-123533783 CTCATGGAGAGGAATGAAAATGG - Intergenic
1197215274 X:123860653-123860675 CATATGAAACTGAAAGAATAAGG + Intronic
1197625491 X:128797515-128797537 CATATGGAGATGACTGAAAATGG + Intergenic
1197899751 X:131357612-131357634 CACATGGATGGGAATGGAAAAGG - Intronic
1197956371 X:131953377-131953399 CACATGTAGCAGAATGAAACTGG - Intergenic
1198233289 X:134713938-134713960 CAGCTGGAACCGAATGAGAAGGG + Intronic
1198505698 X:137299158-137299180 CACATGCAAAAGAATGAAATTGG + Intergenic
1198804401 X:140479653-140479675 TACATAGAAGTGAATGAAAATGG + Intergenic
1198819227 X:140628294-140628316 CATTTTGAACTAAATGAAAATGG + Intergenic
1199337409 X:146635284-146635306 AACATGCAAGAGAATGAAAATGG + Intergenic
1199821309 X:151451087-151451109 CACATGTAAGAGAATGAAACTGG - Intergenic
1200146714 X:153930192-153930214 CACCTGGAGCTGAAAGAGAAGGG - Exonic
1200294177 X:154901497-154901519 CAAATGTAAGTCAATGAAAATGG + Intronic
1200371901 X:155736280-155736302 CACATGGATCTGGATTACAAAGG - Intergenic
1200465662 Y:3514523-3514545 CACATGCAAATGAATAAAATGGG - Intergenic
1200597667 Y:5165469-5165491 CATTTTGAACTGAATGGAAATGG + Intronic
1200622805 Y:5474347-5474369 CACATGCAAATGAATGAAGGTGG - Intronic
1201101421 Y:10678260-10678282 CAAATGGAATGGAATGAAATGGG - Intergenic
1201109398 Y:10788090-10788112 CAAATGGAATGGAATGAAATGGG - Intergenic
1201211382 Y:11683900-11683922 CAGATGGAACGGAATGGAATGGG + Intergenic
1201532046 Y:15002181-15002203 CACATGGAAAAGAAAGAAAAAGG + Intergenic
1201561294 Y:15320307-15320329 CACATGTAACAAAATGTAAATGG - Intergenic