ID: 1124210805

View in Genome Browser
Species Human (GRCh38)
Location 15:27763757-27763779
Sequence GAGGTTGCCCTGGTACTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124210793_1124210805 30 Left 1124210793 15:27763704-27763726 CCTGGGAAGCAGGGCTGCTGGGC 0: 2
1: 0
2: 4
3: 66
4: 534
Right 1124210805 15:27763757-27763779 GAGGTTGCCCTGGTACTGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 175
1124210801_1124210805 -8 Left 1124210801 15:27763742-27763764 CCTCAGGGAGAAGGTGAGGTTGC 0: 1
1: 0
2: 1
3: 35
4: 283
Right 1124210805 15:27763757-27763779 GAGGTTGCCCTGGTACTGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124210805 Original CRISPR GAGGTTGCCCTGGTACTGGG TGG Intronic
900398565 1:2463392-2463414 CAGGTCGCCCTGGTGCTGGTAGG + Intronic
900644346 1:3702284-3702306 GAGGGGGCCCAGCTACTGGGTGG + Intronic
904259832 1:29282058-29282080 GAGGCTGCCTTGGCATTGGGAGG + Intronic
907483441 1:54760489-54760511 GAGGGTGGCCTGGACCTGGGCGG - Intronic
907489661 1:54800864-54800886 GAGGTTGCCCGGGTGCTCGTGGG + Exonic
907669876 1:56464985-56465007 GAGGATGCCCAGGTACTCAGTGG + Intergenic
910899209 1:92101495-92101517 GAGGTTCCCCGGGTCCTGGTGGG - Intronic
912593584 1:110851907-110851929 GAGGATGCCCTGGTGCTCAGAGG - Intergenic
912886522 1:113480343-113480365 GGGGCTGGCCTGGTACTGGGGGG + Intronic
913266923 1:117054424-117054446 GAGGTTGCCTTGGGACTAGCTGG + Intergenic
916074612 1:161193261-161193283 GAGTTTGCACTGGTCCTGGGGGG + Exonic
916765344 1:167854926-167854948 GAGGTTGCCCTGCTTCTGGAAGG - Intronic
919976458 1:202616016-202616038 CAGGCTGCCCTTGTACTGTGGGG - Intronic
922011658 1:221594758-221594780 GAGGTTCCACTGGGGCTGGGAGG + Intergenic
923494741 1:234514313-234514335 GAGGTTCCCTAGGTGCTGGGGGG + Intergenic
1068620448 10:59176433-59176455 GAGGTTGCCTTGGCAGTGGCTGG + Intergenic
1069825639 10:71253579-71253601 CAGCTTGCCCTGGGACTGAGTGG - Intronic
1071894360 10:90049604-90049626 GAGGTTCACTTGATACTGGGAGG + Intergenic
1072016111 10:91348427-91348449 GAGGTTTCCATGGTATTGGGTGG - Intergenic
1072861093 10:99006572-99006594 GAAGCTGGCCTGGCACTGGGTGG + Intronic
1072878762 10:99203496-99203518 GGGATTGGCCTGGCACTGGGCGG - Intronic
1074122918 10:110506552-110506574 GAGATTGCCCTGGTACTCTCAGG + Intronic
1074629936 10:115241458-115241480 GAGGTTTCCCTGGAATTGTGGGG - Intronic
1075993680 10:126859512-126859534 GGGGTTGCCCTGGCACAAGGGGG - Intergenic
1076849111 10:133084337-133084359 GAGGTGGGCCTGGCACAGGGGGG - Intronic
1077406634 11:2385348-2385370 GTGGTTGCCCTGGGACGGGGAGG - Intronic
1077880008 11:6341486-6341508 GAGGATGGCCTGAGACTGGGAGG + Intergenic
1079117283 11:17647860-17647882 GAGTTTGCCCTATTACTGAGGGG - Intergenic
1081227436 11:40541535-40541557 GACCTTGCCTTGGGACTGGGTGG + Intronic
1081666013 11:44917528-44917550 GAGGTGGCCCTGGGGCTGGCAGG + Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1090073520 11:123564160-123564182 GAGGTTGCTATGGTACTGTCAGG - Intronic
1090453616 11:126828315-126828337 GAGGTGGCCCAGGTAGTGGCAGG + Intronic
1092736619 12:11588795-11588817 GAGGATTCCCTGGACCTGGGAGG - Intergenic
1093542706 12:20305863-20305885 GTGGTGGCCCTGGCTCTGGGTGG - Intergenic
1096609769 12:52793452-52793474 GAGGTTTGCCTGGGACTGAGGGG - Intronic
1104623330 12:130334506-130334528 GTGGTTGCCAGGGTAGTGGGGGG + Intergenic
1105502403 13:20983876-20983898 GGGGATGCCCTGGAACTGAGAGG + Intronic
1105502862 13:20988293-20988315 GAGCATGCCCTGGCGCTGGGCGG - Exonic
1105986642 13:25573691-25573713 GTGGCAGCCCTGGTGCTGGGTGG + Intronic
1107178184 13:37423650-37423672 AAGTTTCCCCTGGTCCTGGGTGG - Intergenic
1114363712 14:22004168-22004190 TAGTTTGTCCTGATACTGGGAGG + Intergenic
1114683560 14:24507039-24507061 GAAGTGGCCCTGAGACTGGGTGG + Intronic
1115174325 14:30544944-30544966 GTGGTTGCCCGGGGATTGGGTGG - Intergenic
1115562152 14:34592651-34592673 GAGGATGCCTTGGGCCTGGGAGG - Intronic
1118328072 14:64794962-64794984 GAGGTTGCCCTCATGCTGGGAGG + Intronic
1118561401 14:67087305-67087327 TAGTTTGTCCTGGCACTGGGGGG - Intronic
1119825099 14:77651159-77651181 GAGGATGGCAGGGTACTGGGAGG - Intergenic
1119944064 14:78673423-78673445 GAGGTGGCACTGGCACTTGGAGG + Intronic
1122047175 14:99032478-99032500 GAGGGGGCCCTGGGGCTGGGAGG - Intergenic
1122246516 14:100407018-100407040 GAGGCTGCCCTGGCACGGCGGGG - Intronic
1123017480 14:105382282-105382304 GAGGCTGCCCTGGACCAGGGAGG - Intronic
1124210805 15:27763757-27763779 GAGGTTGCCCTGGTACTGGGTGG + Intronic
1129206063 15:74037605-74037627 GAGGCCACCCTGGTACTGGCGGG - Intronic
1129599206 15:76988428-76988450 GAGGTGGCCCAGGAACTGGTGGG - Intergenic
1130873597 15:87992740-87992762 CAAGTTGCCCTGTTAATGGGAGG + Intronic
1132331173 15:101013349-101013371 GAGGCCGCCCTGGTTGTGGGCGG + Intronic
1132573049 16:652338-652360 AAGACTGCCCTGGTCCTGGGTGG - Intronic
1133784661 16:8964308-8964330 GAGGTTGCCCGGGGACTGCTCGG + Intronic
1134075080 16:11285010-11285032 GAGGATGCCCTGGAGCTAGGCGG + Intronic
1134102158 16:11460097-11460119 GAGGAGGCCCAGGGACTGGGTGG - Intronic
1134658736 16:15967669-15967691 GAGGTTTGCTTGGTCCTGGGAGG + Intronic
1136411305 16:30078985-30079007 GGGGTTGCGCTGGCACTGAGGGG + Intronic
1136533053 16:30882735-30882757 AAGATTGCCCAGCTACTGGGTGG + Intronic
1138450973 16:57093159-57093181 GAGGTCGCCCTGGCTCTCGGCGG + Intronic
1138560296 16:57797327-57797349 CAGGTCGCCCTGGTAGTGTGGGG - Intronic
1140132942 16:72180076-72180098 GAGGTTGCTCATGTACTGTGCGG - Intergenic
1140506722 16:75478272-75478294 GGGGGTGCCCTGGCACTGGCTGG - Exonic
1140747441 16:77993615-77993637 GAGGTTGCTTTGGTAGTTGGTGG - Intergenic
1142111559 16:88334696-88334718 GAGGTTGTCCTGGACCAGGGTGG + Intergenic
1142288861 16:89183554-89183576 GCGTTTGCCCTGGACCTGGGAGG + Exonic
1143465552 17:7134014-7134036 GAGGAGGCCCGGGCACTGGGTGG - Intergenic
1143712044 17:8741938-8741960 GAGGTGGCCCTGGGGCTGGAGGG + Intronic
1146804286 17:35852868-35852890 TAGGTAGCTTTGGTACTGGGAGG + Intronic
1148430969 17:47643163-47643185 GAGGTTACCCAGCTACTGGGAGG + Intergenic
1151308985 17:73282039-73282061 GAGGTTGCACTGTGTCTGGGAGG + Intergenic
1152703229 17:81829788-81829810 GAGGTTGTCCCAGCACTGGGTGG - Intronic
1152881196 17:82816621-82816643 GAGGATCGCCTGGTCCTGGGAGG - Intronic
1153091831 18:1355631-1355653 GTGGTTGCACTGGTGCGGGGGGG + Intergenic
1155786766 18:29912565-29912587 GAGATTGCCCTGGGGCTTGGGGG - Intergenic
1160890109 19:1373271-1373293 GAGGTGGCCCAGGTGCTGGGTGG + Intronic
1161060391 19:2211796-2211818 CAGGCTGGCCTTGTACTGGGGGG - Exonic
1161138105 19:2632631-2632653 GAGGCTGCCCTGGCACTGCAGGG + Intronic
1161572759 19:5039569-5039591 GGGTTGGCCCTGGTGCTGGGGGG + Intronic
1161769374 19:6223047-6223069 GAGGCTGCGCTGGCACTGCGGGG + Intronic
1162876436 19:13624165-13624187 GAGGTTTCCCTGATGCTGGGAGG + Intergenic
1163411366 19:17156929-17156951 GACGTTGCCCAGGTACAGGATGG - Exonic
1164415066 19:28040040-28040062 GTGGCTGCCCTGGGACAGGGAGG + Intergenic
1164495244 19:28754508-28754530 GAGGCTGCACTGTTAGTGGGTGG - Intergenic
1165056143 19:33177358-33177380 GCGGTTGCCATGGTGCTGGCTGG + Intergenic
1165598625 19:37033374-37033396 GATGGTTCCCAGGTACTGGGAGG - Intronic
1166052928 19:40271335-40271357 GAGGTTGACCTGAGCCTGGGAGG + Intronic
1166917330 19:46204305-46204327 GAGCTGGGCCTGGGACTGGGGGG + Intergenic
1167045103 19:47045242-47045264 GCGTTTGCCCTGGGTCTGGGGGG - Exonic
1167727400 19:51225662-51225684 GATGGGACCCTGGTACTGGGAGG + Intronic
925174720 2:1774486-1774508 GAGGTTGGCCAGGTAGTTGGTGG + Intergenic
926228923 2:10988151-10988173 GAGGTTGCCCTGGAGGAGGGTGG - Intergenic
928033094 2:27797983-27798005 GAGGTTGTCATGGGAGTGGGAGG + Intronic
929947642 2:46382551-46382573 GCTGTAGTCCTGGTACTGGGTGG - Exonic
933984664 2:87580703-87580725 GACTTTGCCCTGGCACTGGGAGG + Intergenic
936309187 2:111370097-111370119 GACTTTGCCCTGGCACTGGGAGG - Intergenic
938106303 2:128532938-128532960 GTGGTTGCCTTGGGACTGGGAGG + Intergenic
948067578 2:235092588-235092610 GAGGATGCCCTGGTGCTTGTGGG - Intergenic
948991019 2:241554056-241554078 GAAGGTGCCCTGCTTCTGGGGGG + Intergenic
1170554335 20:17503657-17503679 AAGGGTGGCCTGGTTCTGGGAGG - Intronic
1170785533 20:19463890-19463912 GGGGCAGCCCTGGTAGTGGGTGG + Intronic
1171064058 20:21995750-21995772 GCTGTGGCCCTGCTACTGGGAGG - Intergenic
1172128495 20:32639724-32639746 GAGGTGGCCATGGTGCTCGGTGG - Intergenic
1173249471 20:41357089-41357111 GCAGGTGCCCTGGTACTGAGTGG - Exonic
1175532595 20:59684413-59684435 GAGGTGGCCTTGGTGCTGAGGGG + Intronic
1178278161 21:31257855-31257877 GAGGTTGGCATGGTAGTTGGAGG - Intronic
1178583970 21:33857835-33857857 GTGGTTGCCCTGGTACATGCCGG + Intronic
1179815655 21:43904509-43904531 GAGGGTGCTCTGCTCCTGGGGGG + Intronic
1180093411 21:45543553-45543575 GGGGTTGCCCTGCTGGTGGGCGG - Intronic
1181029042 22:20141209-20141231 CAGGCTGCCCTTGGACTGGGAGG - Exonic
1181293685 22:21817993-21818015 GAGGTGGGCCTGGGTCTGGGAGG + Intronic
1181514210 22:23402141-23402163 CAGGCTGCCCTTGGACTGGGAGG + Intergenic
1181807071 22:25381350-25381372 GGGGGTGCCCCGGGACTGGGCGG + Intronic
1183232290 22:36590584-36590606 GATGGTGGCCTGGTAGTGGGCGG - Intronic
1185112250 22:48906602-48906624 GAGGTGTCCCTGGGCCTGGGGGG + Intergenic
949838357 3:8293277-8293299 GAGGCTGGCCTGGAACTGGGAGG - Intergenic
950800077 3:15543572-15543594 AAGGTGGCCCTGTTCCTGGGAGG + Intergenic
953537131 3:43784940-43784962 GAGGTTGGACTGGGCCTGGGTGG - Intergenic
954364919 3:50140594-50140616 GAGGGTGCCCTGGGGCTGAGAGG - Intergenic
961326943 3:126114612-126114634 AAGGTGTCCCTGGAACTGGGCGG - Exonic
961789690 3:129366618-129366640 GGGGGTGCCCTGGGACAGGGAGG - Intergenic
961894467 3:130155761-130155783 TGGGTTGCTCTGGAACTGGGAGG + Intergenic
962774842 3:138649627-138649649 GAGGTGGCCCTGCTGCTGGAAGG + Intergenic
963630116 3:147721807-147721829 GAGGTTTCCCTGGGGATGGGTGG - Intergenic
963962259 3:151322762-151322784 GATGATGCCTTGGAACTGGGAGG - Intronic
966225147 3:177590236-177590258 GATGTTGTCCTGGGAGTGGGTGG + Intergenic
967270221 3:187726756-187726778 GAGGTTGCCCTTGTAGCGGAAGG + Exonic
968381820 4:103039-103061 GAGGTTGTGCTGGGGCTGGGTGG - Intergenic
968881724 4:3303581-3303603 GAGCTTGCCCTGGTAGTGGGGGG + Intronic
970171198 4:13292196-13292218 CAGGTTACCCTGGTAATGGGAGG - Intergenic
970912684 4:21295500-21295522 GAGCTTGCCAGGGTAATGGGAGG - Intronic
975176631 4:71297111-71297133 GAGGTTTCCCATGTATTGGGAGG + Intronic
976311119 4:83614617-83614639 GAGTTGGCCTTGGTTCTGGGTGG + Intergenic
978077794 4:104554614-104554636 GAGGTTGCAGTGGTAATGAGGGG + Intergenic
978235039 4:106447554-106447576 GAAGTGACCTTGGTACTGGGCGG - Intergenic
983908093 4:173205773-173205795 GAGGCTGGCCTGGTGCTGGGTGG + Intronic
983908161 4:173206045-173206067 GGGGCTGGCCTGGCACTGGGTGG + Intronic
984897156 4:184551495-184551517 GATGGTTCCCAGGTACTGGGAGG - Intergenic
985103962 4:186483900-186483922 GAGGTGGCCGCGTTACTGGGTGG - Intronic
985571474 5:647953-647975 GAGGAGGCCCAGGTACAGGGAGG + Intronic
986326833 5:6682132-6682154 GAGGCTGCCCTGCTCCTGTGAGG - Intergenic
986585990 5:9319112-9319134 GAGGATGCTTTGGTCCTGGGAGG + Intronic
988117921 5:26920419-26920441 GAGTTTCCCCTGGTCCTAGGTGG - Intronic
988237265 5:28561650-28561672 CAGTGTGCCCAGGTACTGGGGGG - Intergenic
988469636 5:31526524-31526546 GAGGTGCCCCAGGGACTGGGGGG + Exonic
988841486 5:35087809-35087831 GAATTTGCCCTGATACTGTGGGG + Intronic
990103846 5:52230741-52230763 GAGCCTGCCCTTGTTCTGGGAGG + Intergenic
991019829 5:61968826-61968848 GAGGCTGTCTTGGGACTGGGTGG - Intergenic
991135469 5:63176892-63176914 GAGTTTTCCCTGGTTCTGTGAGG + Intergenic
992934602 5:81688326-81688348 AAGTTTCCCCTGGTCCTGGGCGG - Intronic
993453818 5:88104558-88104580 GTGGTTGCCAGGGTTCTGGGAGG + Intergenic
1000270295 5:159677586-159677608 AAGGTTCCCCAGGCACTGGGTGG - Intergenic
1001941160 5:175740626-175740648 GAGGTTGTGCTGGTCCTGGGAGG - Intergenic
1004355945 6:14930138-14930160 AAAGTTGACCTGGTACTGGCTGG - Intergenic
1004785302 6:18961695-18961717 GAGGTTTCCCTGCTACTGGCTGG + Intergenic
1005681184 6:28210080-28210102 TAGGTTTGCCTGGGACTGGGGGG + Intergenic
1006579278 6:35067268-35067290 GCAGATGCCCTGGGACTGGGAGG + Intronic
1006615108 6:35320995-35321017 GAGCTTTCCCTGGAGCTGGGAGG + Intronic
1007048313 6:38799771-38799793 GGGGTTGCCTTGGGGCTGGGAGG - Intronic
1007512866 6:42387895-42387917 GAGGATGGCTTGGGACTGGGAGG - Intronic
1010643985 6:78364905-78364927 GAGGTTGCCCGGATACTTGAAGG - Intergenic
1011102855 6:83743697-83743719 GACTTTCCCCTGGTCCTGGGTGG + Intergenic
1017954296 6:159165940-159165962 GAGGTTGCTCTGGGGCTGGATGG - Intergenic
1019266139 7:118511-118533 GAGGTCACACTGGAACTGGGAGG - Intergenic
1020519909 7:9172938-9172960 GAGGTCCCCCAAGTACTGGGTGG + Intergenic
1025210125 7:57015527-57015549 GAGGTTGACGTGGCACTGGGAGG - Intergenic
1025661826 7:63561324-63561346 GAGGTTGACGTGGCACTGGGAGG + Intergenic
1029337210 7:99912077-99912099 GTGGTTGCCCTGGTAGGGGAAGG + Intronic
1029424192 7:100486326-100486348 GAGGCTGCTCTGGTCCTGGAGGG + Intronic
1029606167 7:101600747-101600769 GAGGTTGCCCAGTCCCTGGGTGG - Intergenic
1034073873 7:148213591-148213613 GAGGTGGACCTGGGACTTGGAGG - Intronic
1034680628 7:152925296-152925318 GGGCTTGCCCTGGGCCTGGGAGG + Intergenic
1037315038 8:17592662-17592684 GAGGTTAGCCCGGTACTGAGGGG - Intronic
1037407573 8:18559827-18559849 GAGCAAGCCCTGGTATTGGGAGG - Intronic
1037584751 8:20268741-20268763 GAGGTTGCTGAGGTGCTGGGGGG + Intronic
1037815480 8:22109542-22109564 GGGGCCGCCCTGGAACTGGGGGG + Intergenic
1045601612 8:103723587-103723609 TGGGCTGGCCTGGTACTGGGTGG + Intronic
1049273629 8:141708877-141708899 GATGTTGGCCAGGTTCTGGGGGG + Intergenic
1053830867 9:42079240-42079262 GAGGTTGCCCTGCTGCATGGGGG - Intronic
1054599689 9:67108197-67108219 GAGGTTGCCCTGCTGCATGGGGG + Intergenic
1059140730 9:111850939-111850961 GAGGATGCCCTGAGCCTGGGAGG - Intergenic
1060015278 9:120081290-120081312 GAGGCTGGCCTTGTAGTGGGTGG - Intergenic
1060018643 9:120109397-120109419 GAGGTCCCCCTGGTGCTGTGTGG + Intergenic
1062108894 9:134771302-134771324 GAGGGTGTCCTGGTCCAGGGTGG - Intronic
1186505321 X:10086897-10086919 CAGATTGCCCGGGTGCTGGGGGG + Intronic
1187194805 X:17072750-17072772 GAGGCTGCCTTGGGGCTGGGTGG - Intronic
1187277397 X:17828047-17828069 GAGGTTCTACTGGTACTGAGTGG + Intronic
1192763312 X:74118835-74118857 GAGGGTGCCCTGGTGGTGGTGGG - Intergenic
1193508504 X:82371780-82371802 GTGGTTGAGCTGGTACTGCGTGG - Intergenic
1197184377 X:123570364-123570386 CAGGTTGCCAGGGAACTGGGGGG - Intergenic
1198792906 X:140364952-140364974 GGGGTCACCCTGGTCCTGGGTGG - Intergenic