ID: 1124211081

View in Genome Browser
Species Human (GRCh38)
Location 15:27765604-27765626
Sequence ACAGCTTAGAAGGTTATAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124211081 Original CRISPR ACAGCTTAGAAGGTTATAGC TGG Intronic
906782159 1:48582354-48582376 ACATCTTAGAATGTCAGAGCTGG + Intronic
911455892 1:98123239-98123261 ACAGTTAAGAAAGTTATAGGAGG - Intergenic
912818511 1:112849279-112849301 AAAGATTAGAAGGTTACAGGTGG + Intergenic
918556039 1:185800115-185800137 ACAGCCTACAAGGTGATAGTGGG + Intronic
924403981 1:243722101-243722123 ACAGCTTAGCAGGTCACAGCAGG + Intronic
1064142323 10:12800893-12800915 GCAGCTTAGAAGGTTATGTCAGG + Intronic
1066491140 10:35896477-35896499 ACAGCTTAGAATGCAATTGCTGG - Intergenic
1067007824 10:42681349-42681371 ACAGTTTAGGAGGTCAAAGCGGG + Intergenic
1069661517 10:70126592-70126614 ACAGCTCAGGATATTATAGCTGG - Intronic
1071941539 10:90596608-90596630 ACAACTTAAAAGGCTACAGCAGG - Intergenic
1077927617 11:6697618-6697640 ACAGTTTAGTAGGTTATGGAAGG + Intergenic
1078873959 11:15375502-15375524 ACAGATTAGAAGGTGAAAGAAGG - Intergenic
1079418889 11:20267559-20267581 ACAGCTTAATTGGTTAAAGCTGG + Intergenic
1080937909 11:36882728-36882750 ACAGCATAGATGGTTATGGACGG + Intergenic
1082885473 11:58077658-58077680 ACAGCTTTTATGATTATAGCTGG - Intronic
1084732071 11:71080107-71080129 ACAGCTGAGAGGGTGATAGGAGG + Intronic
1088821933 11:113463982-113464004 ACATGTTAGAAGGTTACAGGTGG + Intronic
1089936371 11:122368516-122368538 ACAACATAGCAGGTTAAAGCTGG - Intergenic
1095735373 12:45550348-45550370 AAAGCCTGGAAGGATATAGCTGG - Intergenic
1096902506 12:54899992-54900014 ACATCTTAGATGGTTGGAGCAGG + Intergenic
1099343486 12:81468873-81468895 ACAGCTAAGAAGTTTATCACTGG + Intronic
1102109348 12:110352755-110352777 TCAGCTTAGTAGGTAATAGTTGG + Intergenic
1103910232 12:124348163-124348185 CCAGCATCGAAGGTGATAGCAGG - Exonic
1106471241 13:30056526-30056548 TCAACTGAGAAGTTTATAGCAGG - Intergenic
1107511885 13:41093493-41093515 ACATCTTACATGGTTAGAGCAGG - Intergenic
1112198335 13:97248482-97248504 ATAGCTTAGTTGGTTAAAGCAGG + Intronic
1124211081 15:27765604-27765626 ACAGCTTAGAAGGTTATAGCTGG + Intronic
1126208546 15:46073829-46073851 ACAGCTTAATTGGTTATAGCTGG + Intergenic
1128944746 15:71812618-71812640 ACAGCTTGGATGGTGATGGCTGG + Intronic
1131291875 15:91113516-91113538 AAAGATTAAAAGGTTATAGCTGG + Intronic
1132461617 16:58124-58146 ACAAGTTAGAAGGTTATGACAGG + Exonic
1137960246 16:52875715-52875737 AGAACTGGGAAGGTTATAGCTGG - Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140030533 16:71334790-71334812 CCTGCTTAGAAGGTAACAGCTGG - Intergenic
1142186369 16:88696673-88696695 TCAGCTTTGAAGGTGACAGCGGG + Exonic
1148581022 17:48743811-48743833 TCAGCTTAGAAGGGTAAAGCAGG - Intergenic
1161956703 19:7500076-7500098 GTAGGTTAGAAGGTAATAGCTGG - Intronic
1164151222 19:22553467-22553489 ACAGCTTAGAAGGTTGGACTAGG - Intergenic
1164267506 19:23633271-23633293 ACAGCTGAGAAGCCTATAGATGG + Intronic
1164548947 19:29191753-29191775 ATAGCATAGAAGGCTTTAGCAGG + Intergenic
1202646368 1_KI270706v1_random:145595-145617 ACAGTTTAGGAGGTCAAAGCAGG + Intergenic
926845245 2:17129864-17129886 ACAGGTTAAAAGGAAATAGCAGG + Intergenic
930092788 2:47543600-47543622 ACAACCTAGAAGGTGATAGGGGG + Intronic
932371150 2:71189125-71189147 CCAGCTTGGAAGGCTAAAGCAGG - Intronic
933011345 2:77068242-77068264 ACAACTTACAAGTTTCTAGCTGG - Intronic
934509511 2:94926034-94926056 ACAGTTTAGGAGGTCAAAGCAGG + Intergenic
936676488 2:114721794-114721816 ACAGGTTAGAAAATAATAGCTGG + Intronic
944907406 2:204276287-204276309 TCAGCTTGGAAGGGTAAAGCAGG - Intergenic
944957825 2:204833242-204833264 GCATCTTTGAATGTTATAGCTGG + Intronic
1170148435 20:13202760-13202782 ACAGCTGAGTTGGTTACAGCTGG + Intergenic
1177859787 21:26439054-26439076 AGAGGTCAGAGGGTTATAGCAGG + Intergenic
1180355579 22:11836873-11836895 ACAGTTTAGGAGGTCAAAGCAGG - Intergenic
1180382674 22:12155451-12155473 ACAGTTTAGGAGGTCAAAGCAGG + Intergenic
955865334 3:63376180-63376202 ACGACTTAGAAGATTGTAGCAGG - Intronic
959706365 3:109341963-109341985 ACTGCTCAGAAGGCTAAAGCGGG - Intergenic
963447895 3:145438869-145438891 ACAGCTTAATTGGCTATAGCAGG - Intergenic
966298622 3:178453226-178453248 TCAATTTAGAAGGTTAGAGCAGG + Intronic
967715114 3:192753725-192753747 GCAGCTTAGAAAGTCATTGCAGG - Intronic
972131665 4:35843537-35843559 GGAGCTCTGAAGGTTATAGCAGG - Intergenic
973372592 4:49263739-49263761 ACAGTTTAGGAGGTCAAAGCAGG + Intergenic
973388401 4:49531320-49531342 ACAGTTTAGGAGGTCAAAGCAGG - Intergenic
975831669 4:78375407-78375429 ACAGCTGGGAAGGTTAGAGGAGG + Intronic
976588194 4:86822459-86822481 ACAGCTTAGAAGGATACACATGG + Intergenic
978432177 4:108644237-108644259 ACTGCTTACATGGTCATAGCTGG + Intergenic
979386346 4:120069348-120069370 ACAGCTTATAAGGATAAAGGAGG + Intergenic
980275649 4:130646750-130646772 ACAGCCTAGCAGGTCATAGTGGG - Intergenic
980726640 4:136770046-136770068 ACAGCTTAAAGGGTAAAAGCAGG - Intergenic
982028294 4:151274609-151274631 ACAGCTTAAGAGCTCATAGCAGG - Intronic
982075540 4:151732959-151732981 ACAGCTAAGAAGGTGTTAGGAGG + Intronic
983178871 4:164623646-164623668 TCAGCTGAGACGGTAATAGCTGG - Intergenic
983550539 4:169012816-169012838 TTAGCTGAGAAGGTTACAGCAGG + Intergenic
988247755 5:28709909-28709931 ACAGCTTAGAAGGTTATGCCAGG + Intergenic
993009860 5:82468388-82468410 TCAGCTAAGAAGGTGATGGCAGG - Intergenic
1009349946 6:62661591-62661613 ACAGGTTAGAGGGGCATAGCAGG + Intergenic
1009896522 6:69757473-69757495 ATAGCTTAGAAGGTTGTATCAGG - Intronic
1010404920 6:75493861-75493883 ACAGCTGAGAAGTTTGGAGCCGG + Intergenic
1011664520 6:89621802-89621824 ACAGCTTAGAGGGTGAGAGCAGG - Intronic
1015033533 6:128625250-128625272 ATTGCTTTGAAGGTTATGGCAGG + Intergenic
1016604734 6:145907347-145907369 GCAGCTTAGGAGGCTACAGCAGG - Intronic
1018051856 6:160016191-160016213 ACAGCATAGCAGGCAATAGCAGG - Intronic
1022815464 7:33909830-33909852 ACAGCTTAAAAGTTTAAATCAGG - Intronic
1023647777 7:42337227-42337249 ACTGCTTAGATGGTTATAAAGGG - Intergenic
1026064765 7:67060514-67060536 ACAGCTCATAGGGTTACAGCAGG - Intronic
1026713532 7:72766171-72766193 ACAGCTCATAACGTTACAGCAGG + Intronic
1027750018 7:82131374-82131396 ACAGCTTGATTGGTTATAGCTGG - Intronic
1028574017 7:92325933-92325955 ACTGCTTTGAAGGTTATTGCTGG + Intronic
1032545942 7:132742667-132742689 ACAGGTTAGAAGGCTACTGCAGG - Intergenic
1034402509 7:150873849-150873871 ACTGTTTAGTAGGTTATAGTGGG + Intergenic
1035549147 8:506779-506801 ACAGCTCTGAAGGTTAGTGCTGG - Intronic
1038497831 8:28016992-28017014 AGAGCTTAGAAAGTCAGAGCTGG - Intergenic
1038790739 8:30665962-30665984 ACAGCTTAGGAGGTTAGAAAGGG - Intergenic
1041586513 8:59526706-59526728 ACATTTTGGAAGGTTATAGCTGG + Intergenic
1042066362 8:64881392-64881414 ACATCTTAGTATGTTAAAGCTGG + Intergenic
1042677920 8:71343186-71343208 ACTGGTTTGAAGGTTACAGCAGG + Intronic
1043262276 8:78217169-78217191 AAAACTTACAAGGTTATATCAGG + Intergenic
1045051650 8:98332649-98332671 ACAATTTTGAAGGCTATAGCTGG - Intergenic
1051540461 9:18210725-18210747 GCAGCTTAGAAGGGTATACTAGG + Intergenic
1053655913 9:40218245-40218267 ACAGTTTAGGAGGTCAAAGCAGG - Intergenic
1053906262 9:42847450-42847472 ACAGTTTAGGAGGTCAAAGCAGG - Intergenic
1054368021 9:64364469-64364491 ACAGTTTAGGAGGTCAAAGCAGG - Intergenic
1054528699 9:66158049-66158071 ACAGTTTAGGAGGTCAAAGCAGG + Intergenic
1056715225 9:89023011-89023033 ACAGCTTGGAAGGTTTTTCCAGG + Intronic
1057867403 9:98692479-98692501 AGAGAGTAGAAGGTTATAGATGG - Intronic
1058565420 9:106279207-106279229 ACAGCATAGGAGATCATAGCTGG - Intergenic
1203552911 Un_KI270743v1:179258-179280 ACAGTTTAGGAGGTCAAAGCAGG - Intergenic
1198148060 X:133878669-133878691 ACAGCTAAGAAGTTTGCAGCAGG - Intronic
1201154176 Y:11114832-11114854 ACAGTTTAGGAGGTCAAAGCAGG - Intergenic