ID: 1124212857

View in Genome Browser
Species Human (GRCh38)
Location 15:27777324-27777346
Sequence CAAGGGACTCCCTTCTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124212857 Original CRISPR CAAGGGACTCCCTTCTAGGG AGG Intronic
902203519 1:14851337-14851359 CTAGGGGCTCCCTTCTGCGGTGG + Intronic
902289082 1:15425099-15425121 CAAGGTTCTGCCATCTAGGGTGG + Intronic
907945730 1:59134956-59134978 CAAGGGTCTTCCCTGTAGGGTGG + Intergenic
911945338 1:104100321-104100343 CTTGAGACTCCCTTCAAGGGTGG - Intergenic
912335991 1:108863357-108863379 CAAGTGACTCCATTCTAGTTTGG + Intronic
919914172 1:202129845-202129867 CACTGGACTCCCTCCAAGGGGGG - Exonic
1065895617 10:30160874-30160896 CAAGGGAAGCCATTCTAGGCTGG + Intergenic
1067913505 10:50371782-50371804 CAAGGGACTGGCATCTAGTGAGG + Intronic
1068697201 10:59980239-59980261 CAAGGCACTAGCCTCTAGGGAGG - Intergenic
1070442083 10:76456197-76456219 CAAGGGCCTGGCTTCTAGAGTGG + Intronic
1072629456 10:97135384-97135406 AAGGGGCCTCCATTCTAGGGAGG - Intronic
1073084378 10:100878991-100879013 CAGGGGACTGCAGTCTAGGGAGG + Intergenic
1073429691 10:103478085-103478107 CATAAGACTCCCTTCTAGAGAGG + Intronic
1079328746 11:19516728-19516750 CAAGGGACTTCCTGCTGGGCTGG + Intronic
1082883953 11:58064806-58064828 CCAGGGAGTCCCTCCTTGGGAGG + Intronic
1086766812 11:90705717-90705739 CAAGGAACTGGATTCTAGGGTGG - Intergenic
1090550541 11:127815154-127815176 CCAGGGACTCTCTTCAATGGTGG - Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1091750655 12:3019559-3019581 CAAGGGTCCCTCTTCTCGGGAGG - Intronic
1091985384 12:4906949-4906971 CAAGGAACTCACATCTAGGTAGG + Intergenic
1093213749 12:16338206-16338228 TAAGGTACTCCCTTCTTAGGTGG - Intergenic
1094269921 12:28602081-28602103 CAAGGGACCTCTTTCTAGGATGG - Intergenic
1094833476 12:34311434-34311456 GAAGGGACTTCCTTCTGTGGGGG + Intergenic
1095702850 12:45208316-45208338 CAAGGGACTCACATCTGGAGAGG - Intergenic
1096537693 12:52286042-52286064 CAGCGGACTTCTTTCTAGGGTGG + Exonic
1096768815 12:53918777-53918799 CAAGGGGCCCACATCTAGGGAGG + Intergenic
1097840971 12:64320779-64320801 CAAGGGACTCCCTTCTGTTTTGG - Intronic
1098217964 12:68239720-68239742 CAAAGGACTCCATTCTACTGTGG - Intergenic
1104620503 12:130308247-130308269 AGAGGGACTCCCTTCAAAGGTGG - Intergenic
1106976714 13:35226314-35226336 GAAGCAGCTCCCTTCTAGGGAGG + Intronic
1107024575 13:35786516-35786538 CCAGGGGCTCCCTTCCAGGAGGG - Intronic
1113459364 13:110471228-110471250 CACGGGGCTCCCCTGTAGGGGGG + Intronic
1115961146 14:38837167-38837189 CCTGGGACTCCCCTCCAGGGTGG - Intergenic
1116352699 14:43885601-43885623 ACAGGGAATCCCTTCAAGGGAGG - Intergenic
1118465138 14:66024013-66024035 CAGGGTACTCTATTCTAGGGTGG + Intergenic
1120763992 14:88311809-88311831 CAAGGGACTGACTTTCAGGGTGG - Intronic
1124212857 15:27777324-27777346 CAAGGGACTCCCTTCTAGGGAGG + Intronic
1130667877 15:85885103-85885125 CAAGGGACTCCCTGTGAGGATGG + Intergenic
1135213946 16:20548136-20548158 GAAGGGACTCCCCTCCAGCGAGG + Exonic
1135945517 16:26861494-26861516 CAAGGAACTCCATTCACGGGAGG - Intergenic
1136005324 16:27325173-27325195 CAAGGGCCCCGCTTGTAGGGTGG + Intronic
1136577763 16:31134507-31134529 CAAGGGTCTCCTTTCTTGGAAGG - Intronic
1141616227 16:85211189-85211211 TTAGGGCCTCACTTCTAGGGGGG + Intergenic
1142738486 17:1916877-1916899 AAAGGGACTCCGTTCCAGTGGGG - Intergenic
1143329769 17:6124974-6124996 CAGTAAACTCCCTTCTAGGGAGG + Intergenic
1146301257 17:31691541-31691563 CAAGCGACCCCCTGCCAGGGTGG - Intergenic
1152026422 17:77812322-77812344 GCAGGGACTTCCTTCTAGGAAGG + Intergenic
1159539921 18:69761725-69761747 CAAGAGTCACCCTTCTAGAGAGG - Intronic
1162360873 19:10219771-10219793 CAAGTGACTCCTTTCTGAGGAGG + Intronic
1163679227 19:18671145-18671167 CCAGGGCCTCCCTTCTGGGAAGG - Exonic
1165760968 19:38320959-38320981 CAAGGATCTCCCTTGGAGGGTGG - Intronic
1167701345 19:51048626-51048648 CAAGGGACTCCATTCTGGTTTGG - Intergenic
1167966984 19:53156029-53156051 CAGGGGACTCCCAGCTCGGGGGG + Intronic
927707997 2:25308826-25308848 CAAGGGCCTCCATCCTTGGGTGG - Intronic
935112588 2:100105885-100105907 GAAGGGACTCCCTTTTGGCGGGG - Intronic
935171607 2:100614729-100614751 CCAGGGCCTCCCTGCTGGGGTGG - Intergenic
936992235 2:118378571-118378593 CAAGGGACTCCTGTCCAGAGTGG + Intergenic
940686383 2:156856513-156856535 CTAGGGACCTCCATCTAGGGAGG - Intergenic
941196972 2:162464840-162464862 CAAGGGACTCTGTTCTATGTTGG + Intronic
1168801964 20:649261-649283 CAAGGGGCTCCAGTCTAGTGGGG + Intronic
1172102779 20:32495553-32495575 CAAGGGACTGTCTTCTGGGGAGG - Intronic
1175136748 20:56829932-56829954 CCAGGGCCTCCCTCATAGGGCGG + Intergenic
1183265801 22:36824329-36824351 CTAGGTTCTCCCTTCTTGGGTGG + Intergenic
1183981385 22:41542459-41542481 CAGAGGATTCCTTTCTAGGGTGG - Intronic
950646839 3:14382421-14382443 GAAGGGACTTCCTTCCTGGGTGG - Intergenic
953221683 3:40977518-40977540 CAAGGGTCTCCATTCTAGGGAGG - Intergenic
954533004 3:51337133-51337155 CAAGGCCCTCCTTTCTAGGGGGG - Intronic
956977080 3:74593897-74593919 CAAGTTACTCTGTTCTAGGGTGG - Intergenic
974017703 4:56663839-56663861 CCAGGTCCTCCCTTCTAGGTTGG + Intronic
983045952 4:162986286-162986308 CAGGGGACCCCCTGCTAGGTTGG + Intergenic
985354175 4:189099464-189099486 CAAGCGACTCCATTTAAGGGTGG + Intergenic
985920472 5:2967460-2967482 CCAGGGAGGCCCTTCTAGGAAGG + Intergenic
986029819 5:3883521-3883543 CAAGGGGCTCTCTTCTGAGGTGG - Intergenic
987425960 5:17772777-17772799 CAGGGAACTCCCCTCTAAGGAGG + Intergenic
990205384 5:53423339-53423361 CAAGGTACTGACTTTTAGGGAGG + Intergenic
992355387 5:75977191-75977213 CAAGGGACTCCATTCTGGTTTGG - Intergenic
992647333 5:78823584-78823606 CCAGGGACCTTCTTCTAGGGTGG + Intronic
995691315 5:114829460-114829482 CAAGGGATTCCCTTCTGCTGGGG - Intergenic
999467710 5:151823017-151823039 CAAGGGAGTGCCTTGCAGGGAGG - Intronic
1003949351 6:11103689-11103711 CAAGAGTCACCCTTCTAAGGAGG - Exonic
1005752923 6:28900071-28900093 CAAGGGACTCATTTCAAGGTTGG - Intergenic
1009814261 6:68710673-68710695 CAAAGGAATCCCTTTTAGGAAGG - Intronic
1016266834 6:142242585-142242607 TAAGGGGCTCACTTCTAAGGCGG + Intergenic
1017171788 6:151462690-151462712 CCAGTGATTCACTTCTAGGGAGG - Intronic
1017277751 6:152589668-152589690 TAAGGGACTCCCCTTTAGAGAGG + Intronic
1017485119 6:154895491-154895513 CAAGGGGCTCTATTCTAGTGTGG - Intronic
1018673143 6:166195947-166195969 CTTGGGGCTCCCTGCTAGGGAGG - Intergenic
1019729334 7:2621928-2621950 CCAAGGGCTCCCCTCTAGGGTGG + Intergenic
1023131321 7:37006030-37006052 CAAGGGCCTCCCTTCCAGCTGGG - Intronic
1029142321 7:98419966-98419988 GATGGGATTTCCTTCTAGGGTGG + Intergenic
1029999789 7:105047376-105047398 CAAGGGCCACCCTTGTAAGGCGG + Intronic
1032184511 7:129712625-129712647 CATGGGACTCCAGTCTAGTGGGG + Intronic
1034642494 7:152615330-152615352 GGAGGGACTGCCTTCTGGGGAGG + Intergenic
1034702605 7:153109357-153109379 CAAGGGACTCCTTGGTAGGTAGG + Intergenic
1036242399 8:7091725-7091747 CAAGGGACGCCCGGATAGGGTGG - Intergenic
1038942747 8:32323511-32323533 CAAGGGATGCCCTACCAGGGAGG - Intronic
1040870363 8:52094283-52094305 AAAGGGGCTCCCTACTTGGGAGG - Intergenic
1041152139 8:54945422-54945444 CAAGCGACTCCCCTGAAGGGTGG + Intergenic
1045257519 8:100540852-100540874 CAAGGGACTTCCTCCTCAGGAGG + Intronic
1045382488 8:101641323-101641345 CAAGGGACTTCCATTTAGGTAGG + Intronic
1048467942 8:134683142-134683164 CAAGGGAGCCACTTCTAAGGGGG - Intronic
1049224256 8:141442042-141442064 CAGGGGGTGCCCTTCTAGGGAGG + Intergenic
1051639866 9:19214657-19214679 AAAGGGAATCCCTACTTGGGAGG + Intergenic
1056304899 9:85280576-85280598 CAAAGGACTCTATTCTTGGGAGG + Intergenic
1060898796 9:127239086-127239108 CAAGGGAAGCCCTGCCAGGGGGG - Intronic
1061203592 9:129150700-129150722 CAAGGGACTGCCTTGAAGGTGGG + Intergenic
1061488027 9:130930128-130930150 CAGAGGACCCCCTTCTTGGGGGG + Intronic
1185916248 X:4038834-4038856 CAAGGGACACCTTTCTCAGGGGG - Intergenic
1186433319 X:9522811-9522833 CAAGGGCCTCCATTCAAAGGTGG - Intronic
1186496094 X:10014418-10014440 CAAGGAACTCCCGCCTAGTGTGG + Intergenic
1189298557 X:39936018-39936040 CAAGGAACAGCCTTCTTGGGCGG + Intergenic
1191094705 X:56661840-56661862 CTAGGAGCTCCCTTCCAGGGAGG + Intergenic
1193251796 X:79299360-79299382 CATGGGGCTCCCTTGTAGAGAGG - Intergenic
1195199444 X:102533364-102533386 CAAGGCCCTTCCTTTTAGGGTGG - Intergenic
1195219460 X:102732392-102732414 CAAGAGACACCCTTCTACAGGGG - Intronic
1196079789 X:111619108-111619130 AAAGGGAATTCCCTCTAGGGTGG + Intergenic