ID: 1124213335

View in Genome Browser
Species Human (GRCh38)
Location 15:27782676-27782698
Sequence ATGTCGCATTAGCACTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124213335_1124213339 24 Left 1124213335 15:27782676-27782698 CCCTCATAGTGCTAATGCGACAT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1124213339 15:27782723-27782745 TTCCTAACCTGATTCTTTGGAGG 0: 1
1: 0
2: 1
3: 9
4: 140
1124213335_1124213338 21 Left 1124213335 15:27782676-27782698 CCCTCATAGTGCTAATGCGACAT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1124213338 15:27782720-27782742 CTCTTCCTAACCTGATTCTTTGG 0: 1
1: 0
2: 1
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124213335 Original CRISPR ATGTCGCATTAGCACTATGA GGG (reversed) Intronic
908152716 1:61320181-61320203 ATGTCGTGTTAGCACAATGGAGG - Intronic
908190510 1:61698634-61698656 ATTTATAATTAGCACTATGAAGG + Intronic
914349364 1:146826960-146826982 ATGTCTCATTACCACTAGGTTGG - Intergenic
918742768 1:188156170-188156192 ATGTAGCCTTATGACTATGAGGG - Intergenic
919959824 1:202455574-202455596 ATGTGGCATTATCTATATGATGG - Intronic
920987888 1:210907695-210907717 AAGTAACATTAGCACTTTGATGG + Intronic
1066609560 10:37226794-37226816 ATTTTTCATTAGCAGTATGAGGG + Intronic
1075190887 10:120307603-120307625 ATGTACCATTACCACTTTGAAGG + Intergenic
1075271509 10:121055967-121055989 ATTTTGCATTAGCCCTATAAAGG + Intergenic
1082899629 11:58232865-58232887 ATATGGCATTAGGACAATGAGGG + Intergenic
1082918439 11:58465209-58465231 ATGCAGCAGTATCACTATGAGGG + Intergenic
1089053253 11:115564417-115564439 ATCTCCCATTAGCACTAGGCAGG - Intergenic
1099607621 12:84825603-84825625 ATGACGGATTGGCACTGTGAAGG - Intergenic
1101995853 12:109524426-109524448 CTGTTACATTAGCGCTATGATGG + Exonic
1107340593 13:39401048-39401070 ATGTCACATAAGCTCTATAAAGG - Intronic
1118376633 14:65183235-65183257 ATATCGCATTAACAGAATGAAGG - Intergenic
1124213335 15:27782676-27782698 ATGTCGCATTAGCACTATGAGGG - Intronic
1131455704 15:92580842-92580864 AGGTGGCATCAGCGCTATGAGGG + Intergenic
1138228183 16:55316952-55316974 ATGTGGCATTAAAACTGTGATGG + Intergenic
1139984672 16:70888594-70888616 ATGTCTCATTATCACTAGGTTGG + Intronic
1148396540 17:47312561-47312583 ATGTCCCATTAACACTCTCATGG - Intronic
1149036657 17:52141859-52141881 ATGTTGCATTAGGAGTAGGATGG + Intronic
1156726446 18:40134079-40134101 ATGTATCAGTAGCTCTATGATGG - Intergenic
1159153277 18:64548468-64548490 ATATCACATTAGCAGAATGAAGG - Intergenic
928874479 2:36021377-36021399 ATGTTACATTACCATTATGATGG - Intergenic
932992259 2:76801841-76801863 ATGCCACATTAACACAATGAAGG + Intronic
934722948 2:96594563-96594585 TTGTGGCATTAGGACGATGAAGG - Exonic
945507986 2:210665069-210665091 TTGTTGCATCTGCACTATGATGG + Intronic
945808922 2:214524302-214524324 ATATCACCTTAACACTATGAAGG + Intronic
948964546 2:241367327-241367349 ATTTCTCATTAGCAGTTTGAAGG + Intronic
1177375595 21:20266830-20266852 ATATCTCATTACCACTATGTAGG + Intergenic
1179323294 21:40314191-40314213 ATTTCGTATTATCACTATGACGG + Intronic
1183173423 22:36204567-36204589 TTCTCGCAATAGCTCTATGAGGG - Intronic
960721072 3:120625064-120625086 ATGTTGCATTAGCCCTAGGAAGG + Intergenic
964099968 3:152977535-152977557 ATGACTCATTAGCCCTTTGAAGG - Intergenic
970290388 4:14564924-14564946 GTGTCCTATTAGCACCATGAAGG - Intergenic
974154430 4:58052801-58052823 GTGTAGCATTTGCACAATGAAGG + Intergenic
976961732 4:90984647-90984669 GTGTCAAATTAGCACTAAGAGGG + Intronic
981407036 4:144384309-144384331 ATGTCGTATAAGCTCTATGAGGG - Intergenic
984571543 4:181400490-181400512 TTGTCACTTTAGTACTATGAAGG - Intergenic
992780565 5:80123555-80123577 ATGTCACATTCTCACTATAAGGG - Intronic
994661413 5:102658790-102658812 ATGTCACATTAAGATTATGAGGG - Intergenic
996583513 5:125058322-125058344 ATGTCACATCAGCAGCATGATGG + Intergenic
1004226316 6:13787786-13787808 ATTAGGCATTAGCACTAGGAGGG - Exonic
1008161481 6:48081626-48081648 ATGTCAGATAAGCACTTTGAAGG - Intergenic
1011378840 6:86720639-86720661 ATGTGGCCTTAGCACTTTGAAGG - Intergenic
1015457842 6:133449212-133449234 ATGTTGCTTTTGCACTATGATGG - Intronic
1018423376 6:163659479-163659501 ATTTCCCATTAACACTGTGAGGG + Intergenic
1020840139 7:13206715-13206737 ATATCGCATTAACATAATGAAGG - Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1039321734 8:36439400-36439422 TTCTCTCATTAGCACTGTGAAGG + Intergenic
1042457861 8:69026354-69026376 ATGTAGCATAAGCAGTTTGAGGG + Intergenic
1051673177 9:19532832-19532854 ATGACCCATTAGAACTAGGAAGG - Intronic
1197694140 X:129532872-129532894 ATATAGCATTAGCACTGAGATGG + Intergenic
1202575862 Y:26324062-26324084 ATGTGGCATTATCTATATGATGG + Intergenic