ID: 1124214420

View in Genome Browser
Species Human (GRCh38)
Location 15:27794695-27794717
Sequence CCTTCTCTACACCATCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124214420_1124214424 3 Left 1124214420 15:27794695-27794717 CCCAAATGATGGTGTAGAGAAGG 0: 1
1: 0
2: 0
3: 25
4: 189
Right 1124214424 15:27794721-27794743 TTAAAAATGACATGCTGTTCAGG 0: 1
1: 0
2: 2
3: 25
4: 306
1124214420_1124214425 17 Left 1124214420 15:27794695-27794717 CCCAAATGATGGTGTAGAGAAGG 0: 1
1: 0
2: 0
3: 25
4: 189
Right 1124214425 15:27794735-27794757 CTGTTCAGGTGCATTCTCGTTGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124214420 Original CRISPR CCTTCTCTACACCATCATTT GGG (reversed) Intronic
904471292 1:30737999-30738021 TCTTCTCTACAAGATCATTTTGG + Intronic
908646669 1:66285909-66285931 ACTTCTCTAAACAATCATTTAGG + Intronic
915253108 1:154604515-154604537 CCTTCTCTTGAACCTCATTTGGG + Intronic
915650183 1:157304097-157304119 CCTTGTCAACACCTTGATTTTGG + Intergenic
916791412 1:168128492-168128514 CCTGCTCTACACAAACAATTTGG + Intronic
919657265 1:200209519-200209541 CTGTCTCTACACTATCATGTTGG - Intergenic
919927119 1:202197556-202197578 CCTTCTCGTCACCATCAGATTGG - Intronic
920891206 1:209987077-209987099 CCATATCAACATCATCATTTTGG + Intronic
921625948 1:217378141-217378163 ACTGCTCTTCACCATCATCTTGG - Intergenic
924172249 1:241355699-241355721 CTTTCTGTACACCAGCATGTTGG + Exonic
1063060497 10:2546234-2546256 TCTTCTTGATACCATCATTTTGG + Intergenic
1064696433 10:17970974-17970996 CCTTCTATACCCCATTTTTTAGG + Intronic
1066336239 10:34481252-34481274 CCCTCTCTCCACCCTCATGTAGG + Intronic
1068751074 10:60592963-60592985 CCTTCTCTCCACCAGGATATGGG - Intronic
1070445539 10:76497365-76497387 CTTTCTCTCCTCCATAATTTTGG - Intronic
1071097602 10:81996817-81996839 CATTTTCTATATCATCATTTTGG + Intronic
1075425198 10:122336724-122336746 CTTTCTCTCCCCCATCCTTTTGG + Intronic
1076780954 10:132724326-132724348 CCTGCTCTACACCTTAATTCCGG + Intronic
1078752624 11:14179439-14179461 CCTTCTCTTCCCCATCCATTTGG + Intronic
1079760026 11:24318001-24318023 CCTTCTCTACCTCCTCTTTTAGG + Intergenic
1081501317 11:43669555-43669577 CCTTCCCAACACCTTGATTTTGG - Intronic
1085357979 11:75856813-75856835 CCTACTCTACAGCTCCATTTGGG + Intronic
1086002423 11:81999021-81999043 CATTCTCAACAACATCATTTAGG + Intergenic
1088541547 11:110918959-110918981 CCTACTCTCCACCATCCTTGTGG + Intergenic
1089597542 11:119590526-119590548 GTTCCTCTACACCCTCATTTTGG + Intergenic
1091255151 11:134177311-134177333 CATTCGCTACACCATCATGGTGG - Exonic
1091309028 11:134559859-134559881 TCTTATCTACACCATCAGTCTGG - Intergenic
1092520851 12:9271243-9271265 CCTTATCTGCCCCATCATTTGGG - Intergenic
1092624624 12:10313082-10313104 CCTTCACAATACCATGATTTTGG + Intergenic
1093184716 12:16006633-16006655 CCCTCTCTTCTCCAGCATTTTGG + Intronic
1094009267 12:25789573-25789595 CAATCTGTACACCATCTTTTAGG - Intergenic
1094047847 12:26186940-26186962 CCTTCCCCACTCCATCTTTTTGG + Intronic
1094099082 12:26741936-26741958 ACTTCTCTAAAGCATCTTTTAGG - Intronic
1097961592 12:65536592-65536614 CATTCTTTACAGCAACATTTAGG - Intergenic
1102503418 12:113368582-113368604 CCTTCCCTGCTCCTTCATTTGGG - Intronic
1103917386 12:124382994-124383016 CCTGCTCTGCACCATCCTTCTGG + Intronic
1104313581 12:127676363-127676385 CATTCTATACAGTATCATTTTGG + Intergenic
1104816605 12:131649805-131649827 CCTCCTCCTCACCATTATTTTGG + Intergenic
1105408480 13:20150852-20150874 CTTTCCCTACTCCATCCTTTGGG - Intronic
1106671633 13:31912317-31912339 ACTGATCTACACCATCATTTTGG + Intergenic
1106684976 13:32049121-32049143 CCTTCTCTAAATGATTATTTAGG - Intronic
1109437559 13:62325916-62325938 CCTTCCCTCCACCATCATATAGG + Intergenic
1110744819 13:79039778-79039800 CTTTCTCTCCACAATCTTTTGGG + Intergenic
1111534240 13:89581097-89581119 CCTTCCGTACACCATTTTTTGGG + Intergenic
1113404677 13:110027137-110027159 CTTTCTCTATACCTTGATTTTGG - Intergenic
1116466810 14:45243067-45243089 CATTCTCTATACCAACATTACGG + Intronic
1117542329 14:56760427-56760449 CTTTCTCTTCACCATCAATGTGG - Intergenic
1118386778 14:65262216-65262238 CCTTCTAAATACCATCGTTTTGG + Intergenic
1119640022 14:76307952-76307974 TCTTCTCTACACCTGCTTTTGGG + Intergenic
1120108395 14:80523106-80523128 CCTTCCCTACACCAGCAGTGTGG + Intronic
1120255001 14:82107367-82107389 CCATCTCTCCAGCATTATTTTGG - Intergenic
1121383015 14:93490686-93490708 CATTCTCTTCAGGATCATTTAGG + Intronic
1121728764 14:96171982-96172004 ACTTCCTCACACCATCATTTTGG + Intergenic
1121811309 14:96893386-96893408 GCTTCTCCTCACCATAATTTTGG + Intronic
1122578345 14:102755820-102755842 CCTTCTGTCCACCATCATCACGG + Intergenic
1124214420 15:27794695-27794717 CCTTCTCTACACCATCATTTGGG - Intronic
1125129530 15:36266585-36266607 ACTTCTCTTCACAATCATTCTGG - Intergenic
1126059642 15:44767718-44767740 TATTCTCTCCACCATCATTAAGG - Exonic
1127405520 15:58640891-58640913 ACTTCTCCACACCAATATTTGGG + Exonic
1130864793 15:87923463-87923485 CCTCTGCTACACCATCATTCAGG - Intronic
1139034546 16:62927825-62927847 TCTTCACTTCATCATCATTTAGG + Intergenic
1139062925 16:63276886-63276908 CCTTCTCTCCATGCTCATTTTGG - Intergenic
1140301746 16:73764666-73764688 CCTTTTCTATACCTTCATTTTGG - Intergenic
1147530533 17:41272212-41272234 CCTTCTTTTCATGATCATTTTGG + Intergenic
1147853110 17:43457733-43457755 GCCTCTCTAAACCATCTTTTGGG + Intergenic
1150188781 17:63215607-63215629 CTCTCTGTACCCCATCATTTAGG - Intronic
1150813178 17:68372846-68372868 CCTTCTCTGCACCAGAATTGAGG - Intronic
1150890086 17:69138222-69138244 TCTTCTCCACACAATCATTCAGG - Intronic
1151059455 17:71074399-71074421 TCTTCTCTTCACCATCATTCTGG + Intergenic
1152089173 17:78237501-78237523 CTTACTCTTCACCTTCATTTTGG + Intronic
1152916117 17:83036971-83036993 CCTCCTCAGCACCCTCATTTTGG - Intronic
1160514354 18:79470296-79470318 CCTTTTCTACACCGTCATCATGG + Intronic
1167296181 19:48651428-48651450 CCTTGCCAACACCTTCATTTTGG + Intergenic
1168280571 19:55303395-55303417 CCTTCTCACCAACATCATTCCGG - Exonic
926147942 2:10408168-10408190 CCTTCTCACCAGCTTCATTTAGG + Intronic
928553483 2:32397920-32397942 TCTTCTTTGCACCAGCATTTGGG + Intronic
930235672 2:48886821-48886843 CCTTCTCTAGACCATTGTGTAGG - Intergenic
931579221 2:63754679-63754701 CCTCCTTTACACAATCATTCAGG + Intronic
931820166 2:65943611-65943633 TCTTCTCTATACCCACATTTTGG + Intergenic
933028575 2:77295621-77295643 CCTGCTCGACACCTTCATTTTGG - Intronic
935010178 2:99127391-99127413 CATTCCCTACACTATCCTTTTGG + Intronic
937239905 2:120453259-120453281 CCTTCTCTACATGAGCGTTTGGG + Intergenic
937447395 2:121970639-121970661 CCTTCTCTAACTCACCATTTTGG + Intergenic
940381686 2:153022030-153022052 TCTTCTCTACACTGTGATTTGGG + Intergenic
940800975 2:158132014-158132036 CCTTCTCTAATCCTTCACTTTGG - Intronic
942763409 2:179427081-179427103 CCTCCTTTACATCATTATTTGGG - Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
945580427 2:211587573-211587595 CCCTGCCAACACCATCATTTTGG + Intronic
945741156 2:213663234-213663256 CCTTCTGTACACCATGACTATGG + Intronic
946770054 2:223079839-223079861 CCTTCTCTAAAACATCAAATAGG + Intronic
947326043 2:228978079-228978101 CCTTGACTGCACCTTCATTTTGG + Intronic
947550700 2:231043602-231043624 CAACCTCTCCACCATCATTTTGG + Intronic
947553845 2:231070671-231070693 GCTTCTCTTTCCCATCATTTGGG + Intronic
947753839 2:232546837-232546859 CCTTGTCTTAACCATCCTTTGGG - Intergenic
1173768570 20:45636819-45636841 CCTTCTGTACTGCATGATTTAGG - Intergenic
1174737651 20:52980971-52980993 TCTTCTCTACAGCATCATCTTGG - Intronic
1176922793 21:14708613-14708635 CTTTCTCTGCTCCATCAGTTAGG + Intergenic
1176988060 21:15461071-15461093 CCTTCTCTCTACCATATTTTAGG + Intergenic
1177801986 21:25836897-25836919 CCTTGTCAACACCTTGATTTTGG - Intergenic
1178027988 21:28489969-28489991 GCTTCTCTCTATCATCATTTTGG + Intergenic
1181982470 22:26775081-26775103 CCTTGTCTTCTCCATCATTTAGG + Intergenic
950166611 3:10805541-10805563 CCTTCAAGAAACCATCATTTTGG + Intergenic
951185345 3:19706172-19706194 CCATCTTTCCACAATCATTTTGG - Intergenic
957523013 3:81345321-81345343 CCTAGTCTACACAATCATTTTGG + Intergenic
960585326 3:119315860-119315882 CCTTCCCCACCCCAACATTTTGG - Intronic
961778684 3:129308207-129308229 CCTTCAGGACATCATCATTTGGG + Intergenic
962693257 3:137922668-137922690 CCTACTCTGCACCATCAGGTAGG - Intergenic
963500081 3:146114819-146114841 ACTTCCCTTCACCATCATATGGG - Intronic
963971722 3:151437594-151437616 CGCTCTCTCCACCTTCATTTCGG + Exonic
964069939 3:152619368-152619390 GCTTTTCTCCAGCATCATTTTGG - Intergenic
964623929 3:158740966-158740988 CCTTTTCTCCACCAGCATTCTGG - Intronic
966168298 3:177047299-177047321 CCTTGTCTACTCCAGCACTTAGG + Exonic
970386410 4:15561337-15561359 CTTTCTCTCCACCATCAAGTTGG + Intronic
970653784 4:18207831-18207853 CCTACTCTCCACCATCAAGTAGG + Intergenic
971715814 4:30175382-30175404 CCTTCCCTACAACATGACTTTGG - Intergenic
971755601 4:30704121-30704143 CATTCTCTACACCATTCATTTGG - Intergenic
972658416 4:41089234-41089256 CCTTCTCTTCCCAAGCATTTTGG - Intronic
974064420 4:57064674-57064696 CATTGGCTATACCATCATTTAGG - Intronic
975090530 4:70397379-70397401 CCTGCTCTACACCATCAAGTAGG - Intergenic
976228424 4:82815396-82815418 CCTTCTTTATACCACCCTTTGGG - Intergenic
977414978 4:96721663-96721685 CCGCCTCTACACCTTCATTCAGG - Intergenic
977887518 4:102270344-102270366 CCTGCTCAACAGTATCATTTGGG - Intronic
979018871 4:115468877-115468899 CCTTCTCAATACTATCATATTGG - Intergenic
979268689 4:118733862-118733884 CCTTCTCTCCACCCTCACTTTGG + Intronic
981295785 4:143129579-143129601 ACTTCCCTTCACCATCATATGGG - Intergenic
981451855 4:144907344-144907366 CCTAATCTACTCCATCATATTGG + Intergenic
982073174 4:151713571-151713593 CCTTCTGTACAAAATTATTTGGG + Intronic
983423896 4:167557723-167557745 CCTTCTCCTCACAATTATTTTGG + Intergenic
983863736 4:172738446-172738468 TTGTCTCTACACCACCATTTTGG + Intronic
983944129 4:173567364-173567386 CCTGCTCTAGACCATGCTTTGGG + Intergenic
983986960 4:174071509-174071531 CATTCTCCCCTCCATCATTTTGG - Intergenic
986648497 5:9941554-9941576 CCTTCCCAACACCTTGATTTTGG - Intergenic
986671141 5:10144088-10144110 CCATCTCTACACCTTGATTTTGG - Intergenic
987120850 5:14765079-14765101 CCATCACCACACCTTCATTTAGG - Intronic
989500237 5:42157979-42158001 CCTTCTCTTCACCCTCATAAAGG - Intergenic
990716681 5:58645309-58645331 CATGCTCTACACATTCATTTAGG - Intronic
993034259 5:82739811-82739833 CTTTCTCTTGTCCATCATTTAGG - Intergenic
993384017 5:87242259-87242281 TCTGCTCCACACAATCATTTGGG + Intergenic
1003677236 6:8216520-8216542 TCTTCTCTGCACCAACATTTGGG - Intergenic
1004987784 6:21102326-21102348 CGTTGCCTACACCCTCATTTTGG + Intronic
1007093583 6:39199774-39199796 GCTTCTCTCCACCAGCACTTGGG - Intronic
1007847584 6:44772598-44772620 CCTTCTCTGCACCTTCTTTAAGG + Intergenic
1008016672 6:46528146-46528168 CCTTCTCCATACAGTCATTTAGG + Intergenic
1008840116 6:55892904-55892926 CCTTGTTTACACCTTGATTTTGG - Intergenic
1008845545 6:55958661-55958683 CTTTCTCTAAACCAACATATAGG - Intergenic
1009595358 6:65728692-65728714 CTTTCTCAACCCCACCATTTTGG - Intergenic
1009687270 6:66978479-66978501 CCATCTCTGTACCATGATTTAGG + Intergenic
1009853514 6:69229287-69229309 CCATATATACATCATCATTTGGG + Intronic
1011847431 6:91583672-91583694 CCTTCTCTATCTCATCATGTTGG - Intergenic
1011991102 6:93518809-93518831 ACTTCTTTACACCATTATATTGG + Intergenic
1012004420 6:93694730-93694752 CCTTGTGGACACCACCATTTGGG - Intergenic
1012366631 6:98448777-98448799 CCTTCTCTACAACAACATATAGG + Intergenic
1014126110 6:117779045-117779067 CCTTTTCTACACCCCCAATTTGG + Intergenic
1014398522 6:120957175-120957197 CCATTTCTAAAACATCATTTTGG + Intergenic
1014989410 6:128055402-128055424 CCAACTCTACACCATTACTTAGG - Intronic
1015670277 6:135681310-135681332 CCTTCTCTAAACAATCACTTAGG + Intergenic
1017698817 6:157047536-157047558 CCTTATCTTCACCATCACTAAGG - Intronic
1017899513 6:158707059-158707081 CCATCTCTACACTCTAATTTTGG + Intronic
1018065514 6:160122745-160122767 CCACCTCAACACCATCATTGAGG - Intronic
1018392165 6:163348997-163349019 CCTTCTCCACAGAATCCTTTGGG + Intergenic
1018746228 6:166764377-166764399 CGTTCTCGACACCTTCCTTTAGG - Intronic
1020355474 7:7271081-7271103 CCTTCTTCCCACCATCCTTTGGG - Intergenic
1020479612 7:8642045-8642067 GCTTTCCTTCACCATCATTTTGG + Intronic
1020864519 7:13540757-13540779 CTTTCTCTAGAGCATCTTTTGGG + Intergenic
1021931690 7:25587124-25587146 CCTTCTATTAACCATTATTTTGG - Intergenic
1031236259 7:119182141-119182163 CTTACTGGACACCATCATTTTGG - Intergenic
1032489570 7:132314121-132314143 CCTTCTCTGCACCATCACCAGGG + Intronic
1035425542 7:158769760-158769782 CCTTCACTACACCATAACTTTGG - Intronic
1035824080 8:2626198-2626220 TATTTTCAACACCATCATTTGGG - Intergenic
1036051398 8:5202547-5202569 CCTTGCTGACACCATCATTTTGG + Intergenic
1037083282 8:14814285-14814307 CCTTCTATACCCCATCTTTTAGG - Intronic
1040758559 8:50809692-50809714 CCTTTTCTGTACTATCATTTTGG + Intergenic
1041249603 8:55921503-55921525 TCTTCTCTCCACAATCAATTTGG - Intronic
1041726881 8:61026323-61026345 CCTTGCCTACACCTTGATTTTGG + Intergenic
1044072068 8:87773821-87773843 GTTTCTCCACACCATTATTTAGG + Intergenic
1044572760 8:93738288-93738310 ACTTTTCTACATCATCATTTGGG - Intronic
1045470610 8:102509014-102509036 CCTTCTCTACACAATCATCATGG - Intergenic
1046698796 8:117376399-117376421 CCTTCGCTACACAATGATTGTGG - Intergenic
1047066740 8:121292415-121292437 CCATCTATAGACTATCATTTAGG - Intergenic
1049192655 8:141297154-141297176 TCTTCTCTACACCATCCACTTGG + Intronic
1052043609 9:23769241-23769263 CCTTTACCACACCATCCTTTGGG + Intronic
1052786152 9:32830504-32830526 CCTTCTCTAAACTCTCATATGGG - Intergenic
1055301208 9:74884925-74884947 CTCTCTCTTCACCATCATTTGGG - Intronic
1055400771 9:75921480-75921502 TCTTTTCTGCACCATCATCTCGG - Intronic
1057077328 9:92145010-92145032 CCTTCTCATCACCATCAGATTGG - Intergenic
1059330873 9:113534875-113534897 CCATCTGTAAACCAGCATTTTGG - Intronic
1059821141 9:117973417-117973439 CCCTCTTTCCACCAACATTTTGG + Intergenic
1060002984 9:119975360-119975382 CCATCTTCCCACCATCATTTTGG + Intergenic
1060508781 9:124217178-124217200 CCTTCTCTACATTTTCCTTTAGG + Intergenic
1061179433 9:129015050-129015072 CCTACACTACACCATCAACTGGG + Intronic
1061743861 9:132725843-132725865 CCTGCTCTTCAGCATCCTTTGGG + Exonic
1061813444 9:133177751-133177773 CCTTCTCTATTCACTCATTTTGG + Intergenic
1062228429 9:135467008-135467030 GCTTCTCTACACTTTCATTTAGG + Intergenic
1185827836 X:3269813-3269835 CCTCATCTTCATCATCATTTCGG - Intergenic
1186989201 X:15049486-15049508 CCCTATCAACACCTTCATTTTGG + Intergenic
1187228857 X:17401590-17401612 CCTTGTTAACACCATGATTTTGG - Intronic
1187422705 X:19150146-19150168 CCTTTTCTTCTCCATCCTTTTGG + Intergenic
1189004126 X:36977946-36977968 TATTCTCTCCACCAGCATTTGGG - Intergenic
1189324118 X:40102736-40102758 CCTTCTCTACCCCTCCAGTTCGG - Intronic
1192046685 X:67682732-67682754 CCTTGGCTCTACCATCATTTGGG + Intronic
1192725183 X:73742913-73742935 CCCTCTCTCCACCCTCAATTAGG + Intergenic
1193449457 X:81647542-81647564 CCTTCTATGCACAATCATGTAGG + Intergenic
1193906108 X:87246213-87246235 CCTTCCCTCCACCATCAAGTAGG + Intergenic
1194244159 X:91491108-91491130 CCTTCTCTAGAACACCATTAAGG + Intergenic
1194389319 X:93296228-93296250 CTTTCTCTACATCATCTTTAGGG - Intergenic
1196980422 X:121207896-121207918 CTTTCTCTACCTCATCTTTTAGG + Intergenic
1197056094 X:122121277-122121299 CCTGGTCCACACCATGATTTTGG - Intergenic
1197872910 X:131076397-131076419 CCTTGTTTACACTATCCTTTGGG + Intronic
1197948823 X:131872334-131872356 ATTTCTCTACTCTATCATTTGGG + Intergenic
1198136876 X:133761811-133761833 CCTTCTGGACACCATAATTTGGG + Intronic
1198931005 X:141860121-141860143 GCTCATCTACACCATCCTTTAGG - Intronic
1199280239 X:145992571-145992593 CCTTCTCTTCTCTATCATATAGG + Intergenic
1199854387 X:151748307-151748329 CATTATCTACACCTTCACTTTGG + Intergenic
1199968791 X:152843415-152843437 CCTTGTCAACACCTTGATTTTGG - Intronic
1200760082 Y:7029571-7029593 CCTTCTTTAAAAAATCATTTTGG - Intronic