ID: 1124217189

View in Genome Browser
Species Human (GRCh38)
Location 15:27817071-27817093
Sequence CCAGGAGCGCAGAGCCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124217189_1124217193 2 Left 1124217189 15:27817071-27817093 CCCTCTAGGCTCTGCGCTCCTGG 0: 1
1: 0
2: 1
3: 30
4: 228
Right 1124217193 15:27817096-27817118 TCCTTACTCTCCTATTTACCTGG 0: 1
1: 0
2: 1
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124217189 Original CRISPR CCAGGAGCGCAGAGCCTAGA GGG (reversed) Intronic
900095475 1:938386-938408 CCAGAAGCCCAGAGCCTGGCTGG + Intronic
900413629 1:2525204-2525226 CCAGGAGCACACAGCTCAGAGGG + Intronic
901204407 1:7485601-7485623 CCAGGGGCCCAGAGCCTGGCAGG - Intronic
901780729 1:11593030-11593052 CCAGGATGGCACAGCCTGGAAGG - Intergenic
901788367 1:11639619-11639641 CTAGGAGCTCACAGACTAGAGGG - Intergenic
902667413 1:17949173-17949195 GCAGGAGCGCAGAGCCTGCATGG + Intergenic
903056783 1:20641662-20641684 CCAGGAGAGCAGAGGCTAGGAGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
912369505 1:109163043-109163065 AGAGGAGCGCAGAGCCTAGTGGG + Intronic
912643669 1:111370920-111370942 CCAGGAACTCAGAGACTAGTTGG + Intergenic
913083573 1:115413028-115413050 CCAGGAGAGCAGAGCCCAAATGG + Intergenic
914705304 1:150165222-150165244 CCAGCAGCAGACAGCCTAGAAGG + Intergenic
915707309 1:157857356-157857378 CTAGGAGAGCAAGGCCTAGAGGG + Intronic
917127070 1:171696403-171696425 CCAGGAGGGAGGAGCCAAGATGG - Intergenic
917442111 1:175077457-175077479 CCAGGAGCACAGAGCCAAGCAGG - Exonic
919438732 1:197599219-197599241 CCAGGAAGGCAGAGCATAAAAGG + Intronic
919869502 1:201809766-201809788 CCAGGATCCCAGTGCCTGGACGG - Intronic
920085230 1:203410693-203410715 CAAGGAGCTCAAATCCTAGATGG + Intergenic
920826332 1:209427102-209427124 CTAGGAGCTCCCAGCCTAGATGG - Intergenic
920857608 1:209675666-209675688 CCGAGAGCCCAGAGCCGAGATGG + Exonic
920916642 1:210262923-210262945 CCGGGAGGGCAGAGCAGAGAGGG - Intergenic
922516406 1:226211306-226211328 CCAGGAGCTCACAGACCAGATGG + Intergenic
923098860 1:230796489-230796511 CCTGGAGCTTAGAGTCTAGAGGG - Intronic
924044198 1:240011163-240011185 CCAGGAGCTCACAGTCTGGAGGG - Intergenic
924329373 1:242926643-242926665 CCAGAATCCCAGAGCCTAGCTGG + Intergenic
1062910165 10:1206941-1206963 GCAGGAGGGCAGAGCCGCGAAGG + Intronic
1062931392 10:1354914-1354936 CATGGAGCTCAGAGGCTAGAGGG - Intronic
1065535041 10:26708111-26708133 CAAGGAGCTCAGGGTCTAGATGG - Intronic
1067279867 10:44863053-44863075 GCAGGAACACAGACCCTAGAGGG - Intergenic
1069584452 10:69588664-69588686 CCAGCAGAGCAGAGTATAGAAGG + Intergenic
1073038078 10:100578287-100578309 CAGGGAGCTCAGAGCCTAGCTGG + Intergenic
1073544017 10:104334132-104334154 CCAGGTGCCCAGAGCCAAGGCGG - Intronic
1073852330 10:107635263-107635285 CAAGGAGCTCACAGGCTAGACGG - Intergenic
1074271134 10:111954931-111954953 CAAGGAAAGCAGAGCATAGAAGG + Intergenic
1076595068 10:131620213-131620235 ACAGGAGCGCAGAGTCTAGCAGG + Intergenic
1077335436 11:2001489-2001511 CCAGCAGCACAGAGCCTCCAGGG + Intergenic
1077486462 11:2840964-2840986 CCTGGAGCCTGGAGCCTAGAAGG - Intronic
1079714100 11:23722630-23722652 CCTGGAGCACAGAGCATAGTAGG + Intergenic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1082935829 11:58655711-58655733 CCAGGAGCGCAGGTCCCACATGG - Intronic
1083291074 11:61690550-61690572 TCCTGAGCACAGAGCCTAGAGGG - Intronic
1083330806 11:61897596-61897618 CCAGGAGCACAGGGCTGAGACGG + Exonic
1083455946 11:62778682-62778704 AGAGGTGTGCAGAGCCTAGATGG + Intronic
1083544355 11:63537880-63537902 CCTGGAGCTCACAGCCCAGAGGG + Intronic
1083580954 11:63825079-63825101 ACAGGAGAGCAGAGCATAGCGGG - Intronic
1083581795 11:63829835-63829857 CCAGGAGCTCACAGTCTAGAAGG - Intergenic
1084527233 11:69704781-69704803 CCAGGAGCGCAAAGCCCAGGCGG - Intergenic
1084595464 11:70114220-70114242 CCAGGGGCGCACAGCCCAGAAGG + Intronic
1084608271 11:70185181-70185203 CCAAGAGTGCAGAGCCTACTTGG - Intronic
1084929303 11:72541774-72541796 CCAAGAGCCCAGAGCCTTCAGGG - Intergenic
1085564467 11:77500889-77500911 CCAGGAGCCCAGAGGCTAGCTGG - Intergenic
1089195983 11:116694346-116694368 CCAAGAGGGCAGATCCAAGAGGG + Intergenic
1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG + Intergenic
1089334850 11:117716171-117716193 CCCGGAGCGAGGAGCCAAGAAGG + Intronic
1090248622 11:125235836-125235858 CCAGGAGCTCACAGCCTTGCTGG - Intronic
1202818419 11_KI270721v1_random:56671-56693 CCAGCAGCACAGAGCCTCCAGGG + Intergenic
1091802170 12:3331165-3331187 CCAGGAGGGCTCAGCCTACAGGG - Intergenic
1092729070 12:11511329-11511351 CCTGGACCTCAGAGCCTAAAAGG - Intergenic
1092743658 12:11653507-11653529 CAAGGAGCCCAGAGTCCAGAAGG - Intronic
1096233895 12:49912904-49912926 CCAGGAGCTCACAGTCTAGAGGG + Intergenic
1097023642 12:56037655-56037677 CCATGAGAGCAGAGACTGGAAGG + Exonic
1103749294 12:123148762-123148784 CCAGGAGCTCACAGTCTAGTGGG + Intronic
1104977124 12:132557083-132557105 CCAGGAGTGCAGAGCACACAGGG - Intronic
1106020771 13:25913164-25913186 CCAGGATCGCATAGCCAGGAAGG + Intronic
1106514981 13:30445493-30445515 CCAGGAGCACAGAGACTGGATGG + Intergenic
1107411151 13:40159855-40159877 TGAGGCCCGCAGAGCCTAGAGGG - Intergenic
1107572369 13:41676358-41676380 CCACCAGCCAAGAGCCTAGAGGG + Intronic
1108432577 13:50368833-50368855 ACAGGAGCCCAGAGCCCAGAGGG - Intronic
1109062386 13:57634144-57634166 AAAGGAGCGCAGGGCGTAGATGG - Exonic
1113967889 13:114164856-114164878 CCAGGAGCCCAGAGACTCGGGGG - Intergenic
1114215830 14:20657174-20657196 CCAGGTGGGCAAAGCCTGGAAGG - Intergenic
1114969421 14:28006382-28006404 TCAAGAGAGAAGAGCCTAGATGG - Intergenic
1117060839 14:51961490-51961512 CGTGGAGCCCAGAGCCTAAAGGG + Intronic
1117344319 14:54817891-54817913 TCAGGAGCCCAGAGCAGAGAAGG + Intergenic
1117740009 14:58807578-58807600 CCTGGAGCTCAGAGTCTAGTGGG + Intergenic
1117818466 14:59622809-59622831 CTAGGAGCCCTGAGCCCAGAGGG + Intronic
1119896336 14:78222813-78222835 CAAGGAGCTTAGAGCCTAGTGGG - Intergenic
1120363896 14:83541329-83541351 CCAGGGACTCAGAGCCTCGAGGG + Intergenic
1122200037 14:100116989-100117011 CCAGGAGAGCACAGCCAAGGCGG + Intronic
1122207741 14:100156646-100156668 CAAAGAGCCCAGAGCCCAGAGGG + Intronic
1124037691 15:26071137-26071159 CCAGGAGCTCACAGTCTAAAAGG - Intergenic
1124217189 15:27817071-27817093 CCAGGAGCGCAGAGCCTAGAGGG - Intronic
1127217292 15:56836898-56836920 CCAGGAGCTCAGATTCTAGTGGG + Intronic
1128443416 15:67735874-67735896 CCTGGACCACAGAGCCTAGGAGG - Intronic
1128726779 15:69993870-69993892 CCAGGAGCTCAAAATCTAGATGG - Intergenic
1129055185 15:72814275-72814297 CAAGGAGCTCACAGTCTAGAAGG - Intergenic
1130885186 15:88086927-88086949 CTGGAAGGGCAGAGCCTAGAAGG - Intronic
1131501648 15:92973074-92973096 CCAGGAGCCCAAATCCTAGAAGG + Intronic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1136372921 16:29847431-29847453 CCAGGAAGGCAGAGCCAAGGCGG + Intronic
1137982979 16:53085444-53085466 CCAGGAGCCCAGGGGATAGAAGG - Intronic
1142425791 16:90001613-90001635 CCTGAAGCTCAGAGCCCAGAAGG - Intergenic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1142680263 17:1543476-1543498 GCAGGAGTGCAGAGCCTGGGAGG - Intronic
1143191729 17:5044900-5044922 TCAGGAGCCCACAGCCTAAACGG + Intronic
1144949931 17:18988665-18988687 CAAGGAGGGCAGAGCGTAGCCGG - Intronic
1146471412 17:33127932-33127954 GCAGGAGAGAAGAGGCTAGAAGG - Intronic
1146652433 17:34614906-34614928 CCATGGGAGCAGAGTCTAGAGGG + Intronic
1147743738 17:42682932-42682954 CCAGGAGTCCAGAGCCTGCAGGG + Intronic
1148763675 17:50023080-50023102 CCAGGAGGGCCGAGTCTCGAGGG - Intergenic
1148855986 17:50579613-50579635 CCAGGAGAACAGAGCCTGGGAGG - Intronic
1150603914 17:66675290-66675312 CCAGGAGGGCAGAGCCTCCATGG - Intronic
1150879299 17:69005130-69005152 CCAGGAGGGACGAGCCAAGATGG - Intronic
1151696558 17:75721165-75721187 CCTGGAGCCCGGAGCCTGGAGGG + Intergenic
1151765939 17:76133090-76133112 CCAGGAGCTCAGACCTTGGATGG - Intergenic
1152237852 17:79147737-79147759 CCAGGGGCGCAGAGCCTGCCTGG - Intronic
1152386993 17:79980641-79980663 CCAGCAGCTCAGAATCTAGAAGG - Intronic
1157281764 18:46351002-46351024 CCAGCAGCGCTGAGACCAGAGGG + Intronic
1157289325 18:46398777-46398799 CCAGGAGCACTGAGCCATGAGGG - Intronic
1157320118 18:46627926-46627948 CTAGGAGCTTAGAGTCTAGACGG - Intronic
1160293385 18:77616201-77616223 CCAGGTGCCAGGAGCCTAGAGGG + Intergenic
1160716686 19:579948-579970 CCAGGAGCACAGAGCCTGGGAGG - Intronic
1161353831 19:3808475-3808497 CCAGGAGCTCAGAGGACAGAGGG - Intronic
1161562195 19:4979600-4979622 CGAGGAGCTCAGAGTCTAGTTGG + Intronic
1162849935 19:13423230-13423252 CAAGCAGCTCAGAGTCTAGAGGG + Intronic
1163710405 19:18843236-18843258 CCATGAGCCCAGCACCTAGATGG - Intronic
1164438291 19:28251403-28251425 CCAGGAGAGCAGACCCTGGTGGG - Intergenic
1164504789 19:28850910-28850932 CCATGACCACAGATCCTAGATGG + Intergenic
1164511072 19:28897658-28897680 CCATGAGGGAAGAGCCTACATGG + Intergenic
1164855305 19:31516456-31516478 GAATGAGCGCAGTGCCTAGAGGG + Intergenic
1165453942 19:35900201-35900223 CCAGGATCGCAGGGCCCCGAGGG - Intronic
1166960395 19:46493292-46493314 GCAGCAGCGCAGGGCCGAGATGG - Exonic
926622920 2:15063425-15063447 CCAGGAGCTTACAGGCTAGATGG - Intergenic
927514690 2:23665265-23665287 CCAGGGGCGCAGGGCTTGGAGGG + Intronic
927893076 2:26764491-26764513 CCAGGAGGGCAGGGCCAAGAAGG - Intronic
928335598 2:30395373-30395395 CCAGGAGCCCTGAACCCAGAGGG + Intergenic
929069177 2:38011577-38011599 CTAGGAGCCTATAGCCTAGAAGG + Intronic
930533657 2:52620646-52620668 TCAGGAGCTCACAGCCTAGTTGG + Intergenic
930844296 2:55885115-55885137 CCAGGAGTGCAGAGGCTATGAGG + Intronic
931574873 2:63708751-63708773 CCAGGAGGGTGGAGCCAAGATGG - Intronic
932485395 2:72081465-72081487 CCAGGAGGGAAGTGCCTGGATGG + Intergenic
932806937 2:74792417-74792439 CCAGGAAGGCAGGGCCTAGTAGG + Intergenic
935223783 2:101036381-101036403 GCAGGAGCTCAGAGCCCAGTGGG + Intronic
936095586 2:109528433-109528455 CCAGGAGGGCAGGGCATGGAAGG - Intergenic
937328493 2:121006814-121006836 CCAGGAGCACAGAGTCTACAGGG - Intergenic
937939153 2:127271719-127271741 CCAGGAGCCCAGAGATGAGAGGG + Intronic
938105338 2:128526233-128526255 CCAGGAGGGCTGAGCCACGAGGG - Intergenic
938972078 2:136441979-136442001 TAAGGAGTTCAGAGCCTAGATGG - Intergenic
938988778 2:136606506-136606528 CAAGGAGCTCATAGTCTAGAAGG - Intergenic
942229753 2:173849358-173849380 CCAGGAGCACAGAGCCCAGAGGG - Intergenic
942482481 2:176404203-176404225 CCAGTAGCGCAGGGACTAGGGGG + Intergenic
945986056 2:216354552-216354574 CCAGGAGTGCAGAGATAAGATGG - Intronic
946432447 2:219632866-219632888 CCAGGAGGGCAGCTCCTAGGGGG - Exonic
946769066 2:223069659-223069681 CTGGGAGCGCAGAGCTTATAAGG + Intronic
947237120 2:227952631-227952653 TCAGGAGCACAGTGCCTTGATGG + Intergenic
948052396 2:234988513-234988535 CCAGGGGAGCAGAGCCCAAAGGG + Intronic
948388301 2:237595313-237595335 CCAGGTGCCCAGAGCCTGGCGGG + Exonic
948515188 2:238499080-238499102 GCAGGAGCCCAGAGCCCAGTGGG - Intergenic
948542215 2:238699104-238699126 CCAGGAGCGAAGAGGGTAGGAGG - Intergenic
1169049248 20:2562179-2562201 CCAGCACCACAGGGCCTAGAGGG + Intronic
1170156781 20:13276142-13276164 TCAGGAGCACAGAGCATTGAAGG - Intronic
1170655115 20:18279368-18279390 CCAGCAGCACAGAGTCTAAAGGG - Intergenic
1171013824 20:21522699-21522721 CCAGGAGCCCGGAGCCGGGAGGG - Intergenic
1171265397 20:23767678-23767700 CCAGGAGCTCAGAGTATAGATGG + Intergenic
1171275074 20:23849764-23849786 CCAGGAGCTCAGAGTATAGCTGG + Intergenic
1172126107 20:32626245-32626267 CCAGGAGACCAGAGCCAAAAGGG + Intergenic
1172493365 20:35359767-35359789 CCAAGAAAGCAGAGCCTAGATGG + Intronic
1172780101 20:37431490-37431512 GCAGGAGCTCAGAGTCCAGAGGG + Intergenic
1174125539 20:48302138-48302160 CCAGGATCTCACAGCCTGGAAGG - Intergenic
1174475766 20:50794909-50794931 CCAGGAGCGCCGGGCCGAGCGGG - Exonic
1175357071 20:58376789-58376811 CCAGTAGCTCAGAACCTGGATGG - Intergenic
1175921778 20:62453542-62453564 GCAGGTGGGCAGAGCCTCGAGGG + Intergenic
1175976731 20:62714240-62714262 CCTGCAGCGCAGGGCATAGAGGG + Intronic
1176055069 20:63141028-63141050 CCAGGAGTGCAGAGCTTTGTGGG - Intergenic
1176169798 20:63691630-63691652 CAAGGAGCCCTGAGCCAAGATGG - Intronic
1176267688 20:64219192-64219214 CAAGGACCGCAGAGCTTGGATGG + Intronic
1178799032 21:35774756-35774778 CCAGGAGCTTGGAGTCTAGATGG + Intronic
1179587050 21:42380065-42380087 CCAGGGGCTCAGAACCCAGAGGG - Intronic
1181725607 22:24808835-24808857 CCAAGAGCACACAGCCAAGATGG + Intronic
1182515420 22:30856005-30856027 CCAGGTCCCCAGAGCCTAGCTGG - Intronic
1184165121 22:42722627-42722649 CCAGTATCTCAGAGACTAGAAGG + Intergenic
1184267952 22:43359982-43360004 CCAGGAGCTCAGAGTCTACTAGG + Intergenic
1184334338 22:43844612-43844634 CCAGGTGTGCAGAGCTCAGAGGG - Intronic
1184653558 22:45930351-45930373 CCAGGGCAGCAGAGCCTAGGGGG - Intronic
950106693 3:10393102-10393124 CCAGGAGCTCACAGTCTAGCTGG + Intronic
950493082 3:13317991-13318013 CCAGGAGCGCAGAGCCTTCCGGG + Intronic
951951317 3:28202411-28202433 CTAGGAGGGCAGGGCCAAGATGG + Intergenic
952402237 3:32973928-32973950 CCAGGAGCTCAGATCCTGTAGGG + Intergenic
954539651 3:51385160-51385182 CCAGGAGCCGCGAGCCCAGACGG - Exonic
954934983 3:54318208-54318230 CCAGGAGAGAAGAGCACAGACGG + Intronic
956179128 3:66501092-66501114 CGCGGAGCGCGGAGCCTAGGGGG - Intronic
961066005 3:123878154-123878176 CCAGGAGCACAGTGCCTAGCAGG + Intronic
961809674 3:129514660-129514682 CAGGGGGCACAGAGCCTAGAGGG - Intronic
961820335 3:129572646-129572668 CCTGGAGCTCGGAGCCTACATGG + Exonic
962629266 3:137259355-137259377 CAAGGAGAGCAGGGCATAGAGGG - Intergenic
965734932 3:171810121-171810143 CCTGGAGCGCAGAGCCGCGCAGG - Intronic
966850431 3:184161488-184161510 CCAGGAGCTCTGAGCAGAGAGGG - Intronic
968920655 4:3520832-3520854 CCACGTGGGCAGATCCTAGAGGG - Intronic
968964208 4:3761355-3761377 CCAGGAGCTCACAGCCAAGTTGG + Intergenic
969856372 4:10002950-10002972 CAAGGAGCACAGAGTCTAGTGGG + Intronic
970528037 4:16952732-16952754 CCAGGAGCTCAGAGCCTCCTGGG + Intergenic
973191743 4:47393313-47393335 CAAGAAGCTCAGAGCCTAGTGGG + Intronic
976619534 4:87114449-87114471 CCAGGAGCACAGAGCCCCCACGG + Exonic
977149919 4:93498357-93498379 CCATGAGAGCAGAGCCTTTATGG + Intronic
980179676 4:129388638-129388660 CCAGGAGCTCATAGTCTAGTTGG + Intergenic
981412893 4:144453825-144453847 CCAGGAGCACAGAGACAAGAAGG + Intergenic
985139049 4:186820474-186820496 TCAGAAGCACAGAGCCTGGAAGG - Intergenic
987478288 5:18419846-18419868 CCAGGAGAGTAGAGCCCACATGG - Intergenic
988253908 5:28798787-28798809 CCAGGAGGGAGGAGCCAAGATGG + Intergenic
988716842 5:33836820-33836842 CAAGGTGGCCAGAGCCTAGAGGG + Intronic
989243581 5:39228123-39228145 CCAGGACCCCAGATCCTAGAAGG - Intronic
989631057 5:43483508-43483530 CCAGGGGCGCGGAGCGTAGGCGG + Intronic
992576395 5:78118195-78118217 CCAGGAGGGTGGAGCCAAGATGG + Intronic
992807497 5:80351876-80351898 GCTGGAGCGCAGCGCCTGGATGG + Intergenic
997408713 5:133673399-133673421 CCAGGATAGCAGAGCCAGGAGGG - Intergenic
997750910 5:136344962-136344984 CCATGAGGGCAGAGACTACAGGG + Intronic
998005281 5:138652642-138652664 CCAGGAACTCAAAGCCTAGATGG - Intronic
998550660 5:143074896-143074918 GGAGGAGCTCACAGCCTAGAGGG + Intronic
998848779 5:146335426-146335448 TCAGGAGCTCAGAGTCTAGTAGG - Intronic
999274279 5:150318693-150318715 CCAGGAGGGCTGAGCCATGAGGG + Intronic
999324132 5:150632623-150632645 CCTGGAGGGCAGAGCCGAAAGGG - Intronic
1001492484 5:172165409-172165431 ACAAGAGCAAAGAGCCTAGAGGG + Intronic
1001925362 5:175632211-175632233 CCAAGAGTCCAGAGTCTAGAAGG + Intergenic
1001926005 5:175637637-175637659 CAAGCAGCTCACAGCCTAGAGGG - Intergenic
1002636731 5:180612404-180612426 AGAGGTGGGCAGAGCCTAGATGG + Intronic
1004517800 6:16335413-16335435 CCAGGGGTGCAGAGCCGAGAAGG - Intronic
1006338360 6:33432414-33432436 GCAGGGGGGCAGAGCCAAGAAGG - Intronic
1011899017 6:92269001-92269023 TCATGAGCTCAAAGCCTAGAGGG - Intergenic
1015947257 6:138515538-138515560 CCAGGAGCACAGCTCCTAGCAGG - Intronic
1019525614 7:1479188-1479210 GCAGGAGCGCCGAGCCTGGGTGG + Intronic
1019736559 7:2652787-2652809 CCTGCAGAGCAGAGCCTTGATGG + Intronic
1020135513 7:5585879-5585901 CCAGGAGCCCAGAGCCTTCAGGG + Intergenic
1024524334 7:50335972-50335994 CCAGCAGGGCACAGCATAGAGGG + Intronic
1025161454 7:56664838-56664860 CCAGGAGGGCAGAGCCCAGCAGG - Intergenic
1025212961 7:57031539-57031561 CCAGGAGCTCAGGGTCTAGGAGG - Intergenic
1025658991 7:63545285-63545307 CCAGGAGCTCAGGGTCTAGTAGG + Intergenic
1025927601 7:65972105-65972127 CCAGGAGCTCTGAGCACAGACGG - Intronic
1030521904 7:110607673-110607695 CTAGGAGCTCACAGCCAAGAAGG - Intergenic
1033732784 7:144195500-144195522 CCGGGAGCCCAGGGCCGAGACGG + Intronic
1033743635 7:144294080-144294102 CCGGGAGCCCAGGGCCGAGACGG + Intergenic
1033750267 7:144355517-144355539 CCGGGAGCCCAGGGCCGAGACGG - Intronic
1033978557 7:147133532-147133554 CAAGGAGCATGGAGCCTAGAGGG - Intronic
1035296328 7:157868747-157868769 CCCGGAGTGCACAGCCCAGAGGG - Intronic
1035606984 8:936204-936226 CCCGGTCAGCAGAGCCTAGAGGG + Intergenic
1036030416 8:4964560-4964582 GCAGGAGCACAGAACCAAGAAGG + Intronic
1037858007 8:22385345-22385367 CCAGGAGGGCAGAGACTGGAGGG - Intronic
1037974935 8:23202321-23202343 CCAGGAGCACACAGCCCAGGGGG + Intronic
1039920581 8:41891562-41891584 CCAGGAGAGCAGGGTCTTGAGGG - Intronic
1040548499 8:48420491-48420513 CCAGGAGCTCACAACCTAAAGGG - Intergenic
1046575655 8:116025602-116025624 CCATGAGAGCAGAGCCTATCTGG + Intergenic
1048431807 8:134377698-134377720 CAAGGAGCTCACAGGCTAGAGGG - Intergenic
1048988895 8:139749983-139750005 CCAGGAGCTCACAGCCTGCAGGG + Intronic
1049317380 8:141976530-141976552 CCAGGAGGGCAGAGCCATGTGGG + Intergenic
1050583095 9:7081657-7081679 TCACGAGCCCAGAGCCTACAGGG + Intergenic
1052254067 9:26432975-26432997 CAAGAAGCTCAGAGTCTAGAGGG + Intergenic
1053603404 9:39632774-39632796 CAAGGAGCACAGTGACTAGAGGG - Intergenic
1054250134 9:62709650-62709672 CAAGGAGCACAGTGACTAGAGGG + Intergenic
1054564244 9:66744179-66744201 CAAGGAGCACAGTGACTAGAGGG + Intergenic
1054735096 9:68743121-68743143 CAAGGAGCTCAGAACCTAGTGGG + Intronic
1057706540 9:97399010-97399032 CCAGGAGCTCACAGTCTGGAGGG - Intergenic
1060149692 9:121280424-121280446 CAAGGAGCTTACAGCCTAGAGGG + Intronic
1060961600 9:127684688-127684710 CCAGCAGGTCAGAGCCCAGAGGG - Intronic
1061485355 9:130917827-130917849 CCAGGTGCGCAGGGCTGAGATGG + Intronic
1061654680 9:132079764-132079786 GCTGGAGCGCAGCGCCTGGATGG + Exonic
1061723079 9:132565725-132565747 CCAGGAAGGCAGAGCCCACATGG - Intronic
1062384370 9:136303279-136303301 GCAGGTGCGCAGAGCCTGGGAGG + Exonic
1189323467 X:40099271-40099293 CCCGGAGCGCAAAGCCTCAAGGG + Intronic
1190977946 X:55426513-55426535 TCAGGAGGGAGGAGCCTAGATGG + Intergenic
1199868129 X:151872674-151872696 CCACCAGTGCAGAGCCCAGATGG + Intergenic
1201226737 Y:11825763-11825785 CCAGAATCCCAGAGCCTAGCTGG + Intergenic