ID: 1124217253

View in Genome Browser
Species Human (GRCh38)
Location 15:27817607-27817629
Sequence GTTTCTAAGAGGATCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 8, 2: 25, 3: 43, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124217253_1124217260 2 Left 1124217253 15:27817607-27817629 CCCTCCATGATCCTCTTAGAAAC 0: 1
1: 8
2: 25
3: 43
4: 175
Right 1124217260 15:27817632-27817654 CGGCCCAGAACCCCAGGAGATGG 0: 1
1: 0
2: 0
3: 15
4: 224
1124217253_1124217258 -4 Left 1124217253 15:27817607-27817629 CCCTCCATGATCCTCTTAGAAAC 0: 1
1: 8
2: 25
3: 43
4: 175
Right 1124217258 15:27817626-27817648 AAACTCCGGCCCAGAACCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 183
1124217253_1124217264 11 Left 1124217253 15:27817607-27817629 CCCTCCATGATCCTCTTAGAAAC 0: 1
1: 8
2: 25
3: 43
4: 175
Right 1124217264 15:27817641-27817663 ACCCCAGGAGATGGATTTGCGGG 0: 1
1: 0
2: 1
3: 29
4: 239
1124217253_1124217263 10 Left 1124217253 15:27817607-27817629 CCCTCCATGATCCTCTTAGAAAC 0: 1
1: 8
2: 25
3: 43
4: 175
Right 1124217263 15:27817640-27817662 AACCCCAGGAGATGGATTTGCGG 0: 1
1: 0
2: 0
3: 30
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124217253 Original CRISPR GTTTCTAAGAGGATCATGGA GGG (reversed) Intronic
904345550 1:29866451-29866473 GATAAGAAGAGGATCATGGATGG - Intergenic
904362563 1:29986270-29986292 GTTTTTAAGGGGACCATAGAGGG - Intergenic
904452856 1:30627482-30627504 GTTTTTGAGAGGACCATGGAGGG + Intergenic
905848071 1:41250747-41250769 GATTCTAAGAGCAAAATGGAGGG + Intergenic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
907911774 1:58833584-58833606 GTTTCATAGGGGATCAGGGAGGG - Intergenic
909269768 1:73607562-73607584 GTTACTACCAGGATCATGGCAGG - Intergenic
909376443 1:74947581-74947603 GTTTCTTAGAGAATCATTGTTGG + Intergenic
912102128 1:106222704-106222726 ATTTTTCAGAGGATCATAGAGGG - Intergenic
912681292 1:111730633-111730655 ATTTCTAACAGGAGCATGGGGGG - Intronic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915506189 1:156357809-156357831 CGTTCTAAAATGATCATGGAGGG + Intronic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
916678513 1:167084006-167084028 GCTTGTAAGAGGATCTTGGTGGG - Intronic
918042526 1:180921899-180921921 GTCTCTCAGAGGCTCAAGGAAGG - Intronic
918217528 1:182405628-182405650 AGTTTTAAGGGGATCATGGAGGG - Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
919050960 1:192510762-192510784 GAATCTAAGATGAACATGGAAGG + Intergenic
919382506 1:196876229-196876251 GACTTTAAGGGGATCATGGAGGG - Intronic
920752931 1:208698616-208698638 GTTTTTAAAAGGATCATGGAGGG - Intergenic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
1062937485 10:1399210-1399232 TTTTCTAAGAGGCTGAAGGAGGG + Intronic
1064867262 10:19895197-19895219 GTATCTAAGAGGATGATGATGGG + Intronic
1065910511 10:30299702-30299724 GTCTCTGAGAAGATCAGGGAAGG - Intergenic
1067137920 10:43628040-43628062 GTTACAAATATGATCATGGATGG + Intergenic
1067723389 10:48747812-48747834 GTTTCTGTGACAATCATGGAAGG + Intronic
1067800339 10:49354084-49354106 GTTTCAAAGAGCTTCATGGAGGG - Intergenic
1067854945 10:49784005-49784027 CTGTCTAAGAGGGTCAGGGAAGG + Intergenic
1068517444 10:58041873-58041895 GATTTTAGGAGGATTATGGAGGG + Intergenic
1068531339 10:58190088-58190110 CTTTCTAAGAGGAGCTAGGAAGG - Intergenic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1069175133 10:65280902-65280924 ATTTCTAAGAGGATCATGGAGGG + Intergenic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1073865341 10:107797009-107797031 GTCTCTAAAAGGATCAGTGAAGG - Intergenic
1077749895 11:4955312-4955334 GTATCTCAGAGGATTGTGGATGG + Exonic
1079624921 11:22605662-22605684 TTTTCTAAGAGCAGCAAGGAGGG + Intergenic
1084616776 11:70241692-70241714 GTTTCTACGAGGATGAAGGGAGG + Intergenic
1085471953 11:76764114-76764136 GATTCTAAGAGGAACCTGTAGGG + Intergenic
1090552242 11:127834477-127834499 GTTTCAAAGTAGATCATGAAGGG - Intergenic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1092644406 12:10553862-10553884 TTTTCTAAGAAGTGCATGGAAGG + Intergenic
1093805037 12:23421883-23421905 ATCGCTAAGGGGATCATGGAAGG - Intergenic
1094003251 12:25718979-25719001 GGTGCTGAGAGGATCCTGGAAGG - Intergenic
1094390774 12:29947988-29948010 GCCTCTTAGAGGATCATGGAAGG - Intergenic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1097927917 12:65150933-65150955 GTTTTTAAGAAGGTCCTGGAAGG - Intergenic
1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG + Intergenic
1101823521 12:108202542-108202564 GTTTCTTGCAGGAACATGGATGG + Intronic
1104409752 12:128548154-128548176 GTTTCAAACAGGACCATGAATGG + Intronic
1104559054 12:129827428-129827450 GCTTATATGAGGACCATGGAAGG - Intronic
1105687037 13:22793881-22793903 GATTCTCAGAGGTTCCTGGATGG + Intergenic
1105948968 13:25212709-25212731 ATTACTAAGAGGAACATGGTAGG - Intergenic
1108978236 13:56476771-56476793 TGTTCAAAGAGGATCATGGTAGG + Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1111836094 13:93390078-93390100 GTGTTTAAGAGGAACTTGGAGGG + Intronic
1114786272 14:25603457-25603479 ATTTTTAAGAGGATCATGGTGGG + Intergenic
1115909292 14:38237631-38237653 GTTTCTAGAATGACCATGGAAGG - Intergenic
1118573758 14:67220674-67220696 GTTTCAAAGAGGATAGTGGCAGG + Intronic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1121619687 14:95337500-95337522 GTTGCTTAGAGGATCAGAGAAGG - Intergenic
1123997127 15:25726737-25726759 TTTTCTAAGAGTAGCATGGCTGG - Intronic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124217253 15:27817607-27817629 GTTTCTAAGAGGATCATGGAGGG - Intronic
1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG + Intergenic
1125006970 15:34827665-34827687 GTCTCTAAGAGAAACATTGAAGG - Intergenic
1126738470 15:51754417-51754439 GGTTCAAAGAGGTTCATAGAAGG + Intronic
1126774265 15:52086458-52086480 GTTTTTAAGAGAATTATGAAGGG - Intergenic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1130689872 15:86072916-86072938 GTTTCTAAGCGGATCATGGAGGG - Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1132944301 16:2524108-2524130 GTTTCTAAGATGATCCAGGCAGG - Intronic
1133707059 16:8364773-8364795 GTTTCTCAGCTGATCATGGCTGG + Intergenic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1133948143 16:10366513-10366535 GTTTCCAAGAGAACCAGGGAAGG + Intronic
1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG + Intergenic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138372774 16:56540523-56540545 GTTTTTAAGAGGATCATGACAGG - Intergenic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1141525221 16:84606789-84606811 GACCCTAAGAGGAACATGGAGGG - Intronic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1144741541 17:17585438-17585460 GTCACTGAGAGGACCATGGAGGG - Intronic
1147373995 17:40013414-40013436 GTTTTTAACAGGACCATGGAAGG - Intergenic
1147883905 17:43671648-43671670 TTTTCAGAGAGGATCATGCAGGG + Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1150498589 17:65628730-65628752 TTGCCTAAGAGGATCGTGGAGGG - Intronic
1155329776 18:24703375-24703397 GTCTCTAAGGAGATCATGGAGGG - Intergenic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1156648015 18:39190371-39190393 GTTTGTGAGAGGATCTAGGAAGG - Intergenic
1156762710 18:40612807-40612829 ATTTCTTTGAGGATCATGAATGG + Intergenic
1157115560 18:44859434-44859456 ATTCCCAAGGGGATCATGGATGG + Intronic
1157324924 18:46662128-46662150 GCTTTTAAGGGGACCATGGAGGG - Intergenic
1157733506 18:50025401-50025423 GTTTTTAAGGGGATCACAGAGGG - Intronic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159093020 18:63870767-63870789 GTTTCTAACAAGCTCCTGGAAGG - Intergenic
1159241187 18:65746058-65746080 TTTTCTAAGTGGTTCAGGGAAGG + Intergenic
1159371341 18:67531033-67531055 GTTTAGGAGAGGTTCATGGAAGG - Intergenic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
1166083531 19:40459934-40459956 GTTTCTTCCAGGACCATGGATGG - Intronic
1167482183 19:49739866-49739888 GTTGCTGAGATGATCGTGGAGGG + Exonic
925004612 2:431817-431839 GTTTGTATGAAAATCATGGAAGG - Intergenic
926549118 2:14279772-14279794 GTCTCAAAGAGGAGGATGGATGG - Intergenic
928700713 2:33895967-33895989 CCTTATAAGAGGATAATGGAAGG + Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
931980510 2:67689015-67689037 GATTCTAAGAGCATCATTAAAGG - Intergenic
932360205 2:71098671-71098693 ATTTGTAAGTGGATAATGGAGGG + Intergenic
932841297 2:75085283-75085305 GTTTTTTAGGAGATCATGGAGGG - Intronic
933619448 2:84520713-84520735 GTTCCTCAGAGGAACATGGATGG - Intronic
935116776 2:100143752-100143774 GTTTGGATGAGGATAATGGAGGG - Intergenic
937748315 2:125442388-125442410 GATATTAAAAGGATCATGGAGGG - Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
937930931 2:127204808-127204830 GTTTCTCAGAGGGTCGTGGCAGG + Intronic
938208332 2:129442670-129442692 GTTTCTATGGGGATCATGGAGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
939225202 2:139355352-139355374 TTTTCTAAGAGTATCTTGCAGGG - Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
941783997 2:169478747-169478769 GTTTTTAAGAGGATCACAGAGGG - Intergenic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
943955132 2:194178565-194178587 GTTTTTAAGAGGATTATTGTGGG + Intergenic
944079989 2:195776811-195776833 GATTCTATGAGCATCAAGGAAGG - Intronic
944966903 2:204945250-204945272 GTTCCTAAGGGGATCATGGAGGG + Intronic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1171061602 20:21968837-21968859 GTTTTTAATAGCAGCATGGATGG + Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1175973772 20:62699988-62700010 CTCTCTCTGAGGATCATGGAGGG + Intergenic
1177227476 21:18276490-18276512 CATTCTATGAGGATCAAGGATGG + Intronic
1178910820 21:36671846-36671868 GATTCTAAGGTGATCATGAATGG + Intergenic
1180172447 21:46066867-46066889 GTTTCTAAAGGGCTCCTGGATGG - Intergenic
1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1182543296 22:31057268-31057290 GTTTCTCAGGGCACCATGGAAGG - Intergenic
1183163559 22:36131078-36131100 GTTTCTCAGAGGATCAGGGAGGG - Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1184545977 22:45168344-45168366 CTTTCTAAGAACATCATGAATGG + Intronic
949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG + Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
950655136 3:14431852-14431874 GTTTAAAAGAGGAACAAGGAGGG + Intronic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
958256938 3:91335745-91335767 GTTTTTTACAGGAACATGGATGG - Intergenic
961756884 3:129133342-129133364 CTTTCTTAGAGGGTCATGGTTGG - Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
963353826 3:144185361-144185383 GTTTTTAAAAGGATCATAAAGGG - Intergenic
963772391 3:149401216-149401238 GTTTCTAAGATAATTATGAAAGG + Intergenic
966181254 3:177190622-177190644 GTTTCTTAGATGAAAATGGATGG - Intronic
968021763 3:195398175-195398197 GTTTCTAAGGTTATCAAGGAAGG + Intronic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
973567418 4:52202230-52202252 GTTTCTCAGATGATAATTGAAGG - Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974595385 4:64008106-64008128 GTTTGTAAAGGGATCCTGGAAGG - Intergenic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
977068867 4:92356988-92357010 GTTTCTAAGAGCAACATGCACGG + Intronic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
983249179 4:165325880-165325902 GCTTTTAAGGGGATCCTGGAGGG + Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983844932 4:172506332-172506354 GTTTTTATGAGGATCATGGAGGG - Intronic
984011281 4:174374829-174374851 GTGTCTAAGAGAGTCATGGGGGG + Intergenic
984169022 4:176338922-176338944 GTTTTGAAAAGGGTCATGGATGG + Intergenic
984537639 4:180996896-180996918 TTTTCTAAGGGGTTCAGGGAAGG + Intergenic
984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG + Intergenic
985938499 5:3114997-3115019 GTATCTCAGAGCAGCATGGAAGG - Intergenic
986501115 5:8400962-8400984 GAATCTCAGAGGATCAGGGATGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
990085269 5:51968851-51968873 GTTTCTAAGGGAACCATGGAGGG + Intergenic
992172595 5:74119181-74119203 GTTTCTAAGAATATCATGGATGG - Intergenic
992823214 5:80519709-80519731 TTTTCCAAGAGCATCATGGATGG - Exonic
994937549 5:106273985-106274007 GTCTTTAAGGGTATCATGGAGGG + Intergenic
995494743 5:112729382-112729404 GTTGATAAGGTGATCATGGAAGG + Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
999554554 5:152726230-152726252 CTTTCAAGGAGGTTCATGGAAGG + Intergenic
1001289695 5:170448030-170448052 GCTACTAAGAGGAACATGCAGGG - Intronic
1001721046 5:173857183-173857205 GTTTCTTAGAAGATCATGCAAGG + Intergenic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1003538589 6:6998210-6998232 GTTTCAAAGAAGCTCATAGATGG + Intergenic
1004122393 6:12836976-12836998 GTTTTAAAGAGGAACATAGAGGG - Intronic
1007103670 6:39268673-39268695 GTTTCTAGAAGGAACATAGAAGG + Intergenic
1009186872 6:60584687-60584709 GTTTTTTACAGGAACATGGATGG + Intergenic
1013088595 6:106877652-106877674 GTTTCTAGGAGTTTGATGGAAGG - Intergenic
1014166653 6:118232612-118232634 GGTACTAAGAGTATCAAGGAAGG + Intronic
1014507436 6:122276875-122276897 GTTCTTAAGAGTATCATGAACGG - Intergenic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017358936 6:153543202-153543224 GGTTTTAAGGGGATCATGGAGGG - Intergenic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1022552773 7:31257277-31257299 GTTTCTTAGAGAATCAAGGATGG + Intergenic
1024894590 7:54243174-54243196 GTTTCTAGAAGGACCATGAAGGG + Intergenic
1026286037 7:68963581-68963603 TTTTATAAGGGGATCCTGGAGGG + Intergenic
1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1028173148 7:87623545-87623567 GTTCCAGAGAGCATCATGGAAGG - Intronic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1032669905 7:134073315-134073337 GTTTCTATGATGAGGATGGATGG - Intergenic
1033244881 7:139709510-139709532 GTTGATCAGGGGATCATGGAGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1036038302 8:5044542-5044564 ATTTCTAAGAGGTTCATTGTTGG - Intergenic
1036948984 8:13123093-13123115 GTTTCTAAGTGGAGGATAGAGGG - Intronic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1038583174 8:28767851-28767873 TTTTCCAAGAGGTTCATGGGAGG - Exonic
1038590391 8:28832143-28832165 GTTTCTAAGAGGGAGATGTAGGG + Intronic
1038711282 8:29948921-29948943 GTTTCTTAGAAGATTAAGGAAGG + Intergenic
1039466667 8:37789461-37789483 GTTTCCATGAGGATCAGGAAAGG - Intronic
1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG + Intergenic
1040974052 8:53170332-53170354 ATTTTTAAGGGGGTCATGGATGG - Intergenic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1043357959 8:79435967-79435989 TTCTATAAGAGGAACATGGAAGG - Intergenic
1045261788 8:100581958-100581980 GTTTCCAAGAGGATTTTGTAAGG - Intronic
1045797192 8:106060056-106060078 GTTTTTAATGGGATCATGGAGGG - Intergenic
1045803960 8:106135041-106135063 GGTTTTAAGAGAATCATGGAGGG + Intergenic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1048320053 8:133392265-133392287 GTTTCTATGTGTATCATAGATGG - Intergenic
1048754598 8:137723594-137723616 GTTTTTTACAGGAACATGGATGG - Intergenic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1050685166 9:8160235-8160257 GTTCCTAAGATGATTATTGATGG - Intergenic
1051217856 9:14817815-14817837 GTGCGTGAGAGGATCATGGAGGG - Intronic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG + Intergenic
1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG + Intergenic
1059906308 9:118990691-118990713 GTTGCTAAGAGGAGAAGGGAGGG + Intergenic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1186919017 X:14257028-14257050 GTGTCTAGGAAGATAATGGAAGG + Intergenic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1193468314 X:81872451-81872473 TTTTCGATGAGGACCATGGAAGG - Intergenic
1193476908 X:81977394-81977416 GTTTTTAGGAGGTTCATGAAAGG + Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1196982048 X:121225276-121225298 GTTTTTAGCAGGAACATGGATGG - Intergenic
1197557758 X:127976802-127976824 GTTTCTAAGCAGCTTATGGATGG + Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1200513130 Y:4105213-4105235 GTTCCAAGGAGTATCATGGAAGG + Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic