ID: 1124219373

View in Genome Browser
Species Human (GRCh38)
Location 15:27835883-27835905
Sequence CCTGAAAAGTATACAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124219364_1124219373 11 Left 1124219364 15:27835849-27835871 CCTCTCCCAGTACTGAGGTTGTG 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1124219373 15:27835883-27835905 CCTGAAAAGTATACAGTGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 165
1124219360_1124219373 29 Left 1124219360 15:27835831-27835853 CCCCTAGTGGTCTGCGTGCCTCT 0: 1
1: 0
2: 7
3: 335
4: 6053
Right 1124219373 15:27835883-27835905 CCTGAAAAGTATACAGTGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 165
1124219368_1124219373 6 Left 1124219368 15:27835854-27835876 CCCAGTACTGAGGTTGTGGGGCA 0: 1
1: 0
2: 2
3: 9
4: 136
Right 1124219373 15:27835883-27835905 CCTGAAAAGTATACAGTGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 165
1124219362_1124219373 27 Left 1124219362 15:27835833-27835855 CCTAGTGGTCTGCGTGCCTCTCC 0: 1
1: 0
2: 2
3: 31
4: 669
Right 1124219373 15:27835883-27835905 CCTGAAAAGTATACAGTGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 165
1124219361_1124219373 28 Left 1124219361 15:27835832-27835854 CCCTAGTGGTCTGCGTGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1124219373 15:27835883-27835905 CCTGAAAAGTATACAGTGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 165
1124219369_1124219373 5 Left 1124219369 15:27835855-27835877 CCAGTACTGAGGTTGTGGGGCAT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1124219373 15:27835883-27835905 CCTGAAAAGTATACAGTGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124219373 Original CRISPR CCTGAAAAGTATACAGTGGA GGG Intronic
904495937 1:30886709-30886731 CCAGAAAAGTGCTCAGTGGAAGG - Intronic
905249447 1:36638616-36638638 CCTGAAATGGAAACAGGGGAGGG + Intergenic
908069956 1:60449245-60449267 CCTGAAATGTGCACAGTGGAGGG + Intergenic
908080054 1:60567360-60567382 CTTGAAGATTATACAGTTGATGG - Intergenic
911844719 1:102737069-102737091 CTTGCAAAGTATAGAGTGGTTGG + Intergenic
916284142 1:163085782-163085804 CCTGAAAAGTAAACAGTGCCAGG - Intergenic
917690226 1:177461245-177461267 GTTGAATGGTATACAGTGGAAGG - Intergenic
918222610 1:182449582-182449604 CCTGAAGAGTCTTCAGAGGAAGG + Intergenic
923281957 1:232451947-232451969 TCTCAAAAGCATACACTGGAAGG + Intronic
923863198 1:237913324-237913346 ACTGAAAAATATACAGAGTAGGG + Intergenic
924091673 1:240507728-240507750 GCTGAAAAGTCTTCACTGGATGG + Intronic
1063948882 10:11204164-11204186 CCCTAAAATTGTACAGTGGAAGG + Intronic
1064016076 10:11773291-11773313 CCTGAACAGCAGACATTGGATGG - Intergenic
1065120646 10:22526948-22526970 CTTGAAAAGTACAAAGTTGAAGG - Intergenic
1067599596 10:47586200-47586222 CCTGATCAGTATATGGTGGACGG - Intergenic
1069164147 10:65128940-65128962 CCTGCAAGGTCTACAGGGGAAGG - Intergenic
1069341753 10:67417748-67417770 CCTCATATTTATACAGTGGATGG - Intronic
1070155012 10:73827888-73827910 CCTAAAAAGTGGACATTGGAAGG - Intronic
1071651122 10:87394084-87394106 CCTGATCAGTATATGGTGGACGG - Intergenic
1072423385 10:95308648-95308670 CTTGACAAGAATACAGTGGGAGG - Intergenic
1072605903 10:96982474-96982496 CCGGAAAAGCTTTCAGTGGAGGG - Exonic
1078735040 11:14012030-14012052 CCTGGCAGGTAAACAGTGGATGG + Intronic
1079507225 11:21166972-21166994 CCTAATAAATATACAGTGTAGGG - Intronic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1081369591 11:42283751-42283773 CCTGAAAAGAATACATGGAAAGG - Intergenic
1085735370 11:79034259-79034281 CCTGAAGTGTGTACAGTGGTTGG + Intronic
1085737223 11:79049426-79049448 CCTGAGAAGTATACACTAGGGGG + Intronic
1087489861 11:98811317-98811339 CCTGTGAAGGATACTGTGGAAGG - Intergenic
1088490249 11:110379805-110379827 CCTGAAGAGTATATTCTGGAAGG + Intergenic
1093178669 12:15943322-15943344 ACTAAAAGGAATACAGTGGAGGG - Intronic
1094422772 12:30289274-30289296 TCTGAAAAGAATACAGAGGAAGG - Intergenic
1095897988 12:47300024-47300046 ACTGAAAAGTAAACACTGGCAGG - Intergenic
1096300758 12:50425261-50425283 CATGAAAAAGATACAGTGAAAGG - Intronic
1097130621 12:56808479-56808501 CTTCAAAAGTATAAAATGGAAGG - Intergenic
1099703183 12:86115695-86115717 TCTGAAAAGAATACATTAGAAGG + Intronic
1100961786 12:99970265-99970287 TATGAAAAGTATGCAGTAGATGG + Intronic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1101309178 12:103560829-103560851 CCTGCAAAGTACACAGTATATGG + Intergenic
1106057910 13:26255011-26255033 CTTGAAAAGTATACAGCCCACGG - Intronic
1107216735 13:37929918-37929940 TCTGAAAAGTATACTGTTCATGG + Intergenic
1107444577 13:40458737-40458759 CCTGAAAGCTATTCAGTAGAGGG + Intergenic
1107989396 13:45804031-45804053 CCTAAAAAGTAAACTGTGGCTGG + Intronic
1109670084 13:65593166-65593188 CATGAAAAATGTTCAGTGGAGGG - Intergenic
1111977280 13:94979702-94979724 CCTGAAAAATATTCAGGGCAAGG - Intergenic
1114603632 14:23977202-23977224 CCAGAAAAGAAAACAGTGAATGG - Intronic
1114608643 14:24019976-24019998 CCAGAAAAGAAAACAGTGAATGG - Intergenic
1114914222 14:27241855-27241877 ACTGAAGAGTCTACAGTAGATGG + Intergenic
1117109063 14:52429802-52429824 CCTGAAAAGGATACAGAGGATGG + Intergenic
1117228891 14:53694790-53694812 CTTAAAAAGCATACAGTGCATGG + Intergenic
1117294035 14:54362547-54362569 ACTCAAAGGTCTACAGTGGAGGG - Intergenic
1118169004 14:63366983-63367005 CCTGAAAAGCATATTCTGGAGGG + Intergenic
1119404274 14:74387009-74387031 CCTGAAAAGAATAATGGGGAGGG + Intergenic
1119575599 14:75718712-75718734 TCAGAAAAGGATTCAGTGGAAGG + Intronic
1120080358 14:80209574-80209596 CCACAAAAGTATACATTGAATGG - Intronic
1121589117 14:95086825-95086847 CCTGAAAAGTAATCAGTGGTTGG + Exonic
1124219373 15:27835883-27835905 CCTGAAAAGTATACAGTGGAGGG + Intronic
1124610211 15:31202958-31202980 TGAGAAAAGTATACAGTGTAGGG + Intergenic
1128002614 15:64207482-64207504 CCTTGAAAGTGTTCAGTGGAGGG - Intronic
1128180135 15:65595022-65595044 GCTGATAAATATAAAGTGGATGG + Intronic
1129377458 15:75143053-75143075 CATCAAAAGTATAAACTGGAAGG - Intergenic
1129775514 15:78233868-78233890 ACTGGAATATATACAGTGGAAGG + Intronic
1130329287 15:82908512-82908534 CCTGTAAAGGTTAAAGTGGAGGG - Intronic
1131465720 15:92653694-92653716 CAGGAAAACTATACAGAGGAAGG + Intronic
1135188240 16:20333375-20333397 CCTGAAAAGAAAACAGTGACAGG + Exonic
1136984731 16:35089860-35089882 CCTGAAAAGTTTGCTATGGAAGG - Intergenic
1137069061 16:35882836-35882858 CCAGAAAAGTATTCAGTGAATGG + Intergenic
1138495272 16:57405109-57405131 CCTGAAAAGTTTTGACTGGATGG + Intronic
1140716351 16:77728841-77728863 CCTGAAAACTATAAAGTGGGTGG - Intronic
1144419275 17:15081219-15081241 CTTGCAAAGGATAGAGTGGAAGG + Intergenic
1147211405 17:38874479-38874501 CCCAAAAAGGACACAGTGGAAGG + Intronic
1155475170 18:26230508-26230530 TCTGAAAATCAAACAGTGGATGG - Intronic
1155565707 18:27131956-27131978 CATGAAAGGTATACATTGGTTGG - Intronic
1156128373 18:33936519-33936541 ATTGAAAAGAACACAGTGGAGGG - Intronic
1156902046 18:42311149-42311171 CCTGAAATGTTTCCAGTGGGTGG - Intergenic
1157304044 18:46503746-46503768 CCAGAAAAGCATGCAGTGGAAGG - Intronic
1158627697 18:59085803-59085825 TCTGAAAAGTACACAGTGTTTGG - Intergenic
1158849300 18:61478632-61478654 CATGAGGAGTAAACAGTGGATGG + Intronic
1158943044 18:62424034-62424056 CATGACAAATATAAAGTGGAAGG + Intergenic
1159017536 18:63113914-63113936 TCTGAAATGTGTCCAGTGGAAGG - Intergenic
1161780515 19:6288720-6288742 CATCAAAAGTATAAAATGGAAGG + Intergenic
1162006831 19:7786622-7786644 CCTGAAAAGAGTACAGTGACGGG - Intergenic
1164888235 19:31801466-31801488 ACTGAAAAGTATCGAGTGGGAGG - Intergenic
929116692 2:38450702-38450724 CCAGAAAAGAATCCAGTGGGAGG - Intergenic
933019489 2:77173583-77173605 ACAGGACAGTATACAGTGGAAGG - Intronic
933989230 2:87621760-87621782 CCTGATGAGCATCCAGTGGAAGG - Intergenic
935921041 2:108015432-108015454 GCTGAAGAGAATACAGTAGAAGG + Intergenic
936304613 2:111329066-111329088 CCTGATGAGCATCCAGTGGAAGG + Intergenic
936720443 2:115246129-115246151 CCAAAAAAGTATACAGTGAGAGG - Intronic
939121006 2:138116429-138116451 CATGAAGAGTATATAGTGAATGG + Intergenic
940246477 2:151623352-151623374 ACTGAACAGTATAAAGTAGAGGG - Intronic
940515886 2:154683693-154683715 CTTGAAAAGTGTAAAGAGGAAGG + Intergenic
941316174 2:163995247-163995269 ACTGATAAGTATGCAGGGGAAGG + Intergenic
943342365 2:186695724-186695746 CTTGAAAGGTATACAGTGTATGG + Intronic
947513562 2:230781630-230781652 CTTGAAAAGGATACAGTGTTTGG + Intronic
1169323704 20:4657377-4657399 CCTGAAAAGTAGAGAAAGGAGGG - Intergenic
1172460883 20:35117698-35117720 CCTGAAAAGCCTACAGTGTTGGG - Intronic
1173097969 20:40055353-40055375 ACTTAAAATTATAGAGTGGAAGG + Intergenic
1173125800 20:40335005-40335027 CCTGTTAAGTACACAGAGGAGGG - Intergenic
1177342532 21:19823951-19823973 CCTGGAAAGTATCCCGTGGTAGG + Intergenic
1179770428 21:43611446-43611468 TCTGAAAAGTAAACAGTAGCAGG + Intronic
1179917023 21:44484412-44484434 CCTGAAAAGGAAACAGTGGGGGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
949278517 3:2318273-2318295 CCTATATAGTATACAGTGAAGGG - Intronic
952234398 3:31463941-31463963 GCTGAAAGGTAGAAAGTGGAAGG - Intergenic
953027684 3:39154105-39154127 CCGGAAAAGTAAACTGTGGCTGG + Intronic
955753370 3:62204368-62204390 CCTAAAAAGTTTAAAGGGGAAGG + Intronic
957862171 3:85968015-85968037 GATGGAAAATATACAGTGGAGGG + Intronic
958045980 3:88284317-88284339 CCTGAAAAGTAAGCATTGGTTGG - Intergenic
958961850 3:100518076-100518098 CCTGAACAGTATGAAGGGGAAGG + Intronic
959089721 3:101889033-101889055 CCTTAAAAGTTTACATTAGAAGG - Intergenic
962820205 3:139041393-139041415 CTTAAAAAGTATACCATGGAAGG + Intronic
964129678 3:153272821-153272843 CCTGAGAAGCATACAGGGGAAGG + Intergenic
964407292 3:156362162-156362184 ACTGAAAAGTGTACAGTGAAAGG + Intronic
965928496 3:174012715-174012737 CCTGAAAAGATAACAGTAGATGG + Intronic
966545702 3:181144845-181144867 CCTGAAAAATAGACATTGTATGG - Intergenic
967054346 3:185815816-185815838 CAGGAAAAGTTTACAGTTGAGGG + Intronic
969403571 4:6973569-6973591 TCTGGAAAGTAAACAGTGGCAGG + Intronic
971206491 4:24574769-24574791 CATGTAAAGTATACAGTGTCTGG + Intronic
971583494 4:28374515-28374537 CTTAGAAAGTAAACAGTGGAAGG + Intronic
973328204 4:48885342-48885364 ACTGAAATGTATTCCGTGGAAGG - Exonic
979120391 4:116892330-116892352 CCTGTAAAGTACACGGTGGAGGG + Intergenic
979369207 4:119863151-119863173 ACTGAAAAGCATCCATTGGAAGG + Intergenic
981477725 4:145204645-145204667 ACTAAAAGGTATACAGTGAAAGG - Intergenic
982205068 4:152991568-152991590 CCTGAAAAGGACACAGGGCAGGG + Intergenic
985975919 5:3419042-3419064 CCTGGAAACTATACAGAGCAGGG - Intergenic
987125460 5:14808139-14808161 ACAGAAAAGTATACAAAGGAAGG + Intronic
987132940 5:14875404-14875426 ACAGAAAAGTATACACAGGAAGG - Intergenic
989089108 5:37710906-37710928 TCTGAAAAGTAAACAGTAGTAGG - Intronic
992062238 5:73064722-73064744 CCTGAAAAGTTTCAAGTGGCTGG - Intronic
992079379 5:73219661-73219683 CCTGAAAGGCATGCAGAGGAGGG - Intergenic
992769416 5:80033622-80033644 GCTGACAAGCATGCAGTGGAAGG + Intronic
993597935 5:89882811-89882833 CCTGAAAAGTACATAGAAGAAGG - Intergenic
994245064 5:97469010-97469032 CATCAAAAGTATAAAATGGAAGG - Intergenic
997310381 5:132874877-132874899 CCTGAAGAGTATGGAGTGAAGGG - Exonic
997677414 5:135723326-135723348 TCTGAATGGTATCCAGTGGAAGG + Intergenic
1000617606 5:163446084-163446106 CCTGTAAAGTAGACACTGCAAGG + Intronic
1002392050 5:178921801-178921823 CCTGAGAAGTAAACAGTAGCAGG - Intronic
1003235329 6:4290314-4290336 CCTGAAAACCTTCCAGTGGAGGG + Intergenic
1006933489 6:37701501-37701523 TCTGAAAATCATACAGTGGCAGG + Intergenic
1009972167 6:70635994-70636016 ACTGAATAGTATACACTGAATGG + Intergenic
1010121643 6:72382646-72382668 CCAGAGAAGTAAACACTGGAGGG - Intronic
1011497467 6:87950596-87950618 CCTGAAATGAACACAGTGAAGGG - Intergenic
1011849645 6:91610469-91610491 CCAGATAAGTATACAGAAGAGGG + Intergenic
1012039709 6:94188593-94188615 CTTCAAAAGTATACAGTAGTAGG - Intergenic
1013455950 6:110329917-110329939 TCTGAAAAGTAAACAGTAGCAGG + Intronic
1014325634 6:119989166-119989188 CCTGGAAAGTATCAAGTAGAAGG - Intergenic
1014812976 6:125906180-125906202 CCTTAAAAGTACAGAGAGGAGGG + Intronic
1016379563 6:143461013-143461035 CCTGTAAAGGATAAAGGGGAAGG + Intronic
1017234092 6:152101423-152101445 CCAAACAATTATACAGTGGAAGG + Exonic
1018071633 6:160169932-160169954 CTTGAGAAGTGTACAGGGGAGGG + Intergenic
1021360279 7:19704542-19704564 TATGAAAAGAATAAAGTGGATGG + Intronic
1027499293 7:78928068-78928090 CCAGAAAAGTCCACAGGGGAAGG - Intronic
1027994265 7:85404470-85404492 AGTGAAAAGAATACAGTGGGAGG + Intergenic
1028864709 7:95694561-95694583 CCTAAAAAGTATGCATTAGAGGG + Intergenic
1030552646 7:110983079-110983101 CCTGAAATGAAAACATTGGATGG + Intronic
1030676432 7:112390596-112390618 CCTGAGAAGTAAGCAGTGCAGGG - Intergenic
1030812887 7:113997088-113997110 ACAGCAAAGTACACAGTGGATGG + Intronic
1032995439 7:137441003-137441025 CTTGAAAAGTTTAAAGAGGACGG - Intronic
1038382374 8:27108222-27108244 ACAGAAAAGTATTCTGTGGATGG + Intergenic
1038456823 8:27677450-27677472 GCTGAAGGGTATACAGTGGTGGG + Intergenic
1039796364 8:40918840-40918862 TCTGAAAAAAACACAGTGGAAGG + Intergenic
1043080257 8:75756860-75756882 CCAGTAAAGTGTAGAGTGGATGG - Intergenic
1044472751 8:92589511-92589533 CCTAAAAGGAATTCAGTGGAAGG + Intergenic
1045426111 8:102067401-102067423 CTTTAAAAGTATACAGTTGAAGG - Intronic
1046273013 8:111920346-111920368 AATTAAAAGTAAACAGTGGAGGG + Intergenic
1046690176 8:117275037-117275059 CCTGCAAAGTCTACAGGGGATGG + Intergenic
1049142551 8:140969105-140969127 TCTGAAAAGTAAACAGTAGCAGG + Intronic
1051029438 9:12657407-12657429 CATCAAAAGTATAAAATGGAAGG - Intergenic
1051096207 9:13468360-13468382 CATGAAAAGTATACACAAGATGG - Intergenic
1052450177 9:28619312-28619334 CCTGAAAATTATAAACTAGAAGG + Intronic
1052457145 9:28714287-28714309 CATGAAATGTATAAAGTGCATGG - Intergenic
1053076761 9:35140294-35140316 CATCAAAAGTATAAAGTGGAAGG + Intergenic
1054736573 9:68757909-68757931 CCTGAAAAGTAAATAGTGGCAGG + Intronic
1055819846 9:80248498-80248520 CCTGGAAAGGACACAGTGGATGG + Intergenic
1058448826 9:105077496-105077518 TCTGAATTGTATACAGTGGCTGG + Intergenic
1060428132 9:123523775-123523797 CCTGAAAAGTATTCAATGTATGG + Intronic
1186716293 X:12255375-12255397 CCTGAAGCGTATAGGGTGGAGGG + Intronic
1187998024 X:24950026-24950048 TTTGAAAAGTATACAGTAGCTGG - Intronic
1191129462 X:56992836-56992858 GCAGAAAAGTAAACAATGGAAGG - Intronic
1192131476 X:68555606-68555628 TCTGAAAAGTAAACAGTAGCAGG - Intergenic
1193468513 X:81873765-81873787 CATCAAAAGTATAAAATGGAAGG - Intergenic
1193821949 X:86175650-86175672 CCTGAATAGGAAAGAGTGGATGG + Intronic
1194848361 X:98839482-98839504 CATGAAAAGTAGACAGAGGGAGG - Intergenic
1195496745 X:105544801-105544823 ACTGAAAAGAATGCAGTGAAGGG - Intronic
1197579752 X:128267068-128267090 CCTAAAAAGTGTACAGTGAGGGG - Intergenic
1199419426 X:147627018-147627040 GCTGAGAAGTAGACAGTGAATGG - Intergenic