ID: 1124219688

View in Genome Browser
Species Human (GRCh38)
Location 15:27838834-27838856
Sequence CAGTACCCCTGAGCTTTCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124219688_1124219691 -2 Left 1124219688 15:27838834-27838856 CCTACGAAAGCTCAGGGGTACTG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1124219691 15:27838855-27838877 TGTACCCAGGAGCTGATCTTGGG 0: 1
1: 0
2: 0
3: 10
4: 255
1124219688_1124219694 29 Left 1124219688 15:27838834-27838856 CCTACGAAAGCTCAGGGGTACTG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1124219694 15:27838886-27838908 GATTAGCTTCACCTGTCAAAAGG 0: 1
1: 0
2: 1
3: 17
4: 155
1124219688_1124219690 -3 Left 1124219688 15:27838834-27838856 CCTACGAAAGCTCAGGGGTACTG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1124219690 15:27838854-27838876 CTGTACCCAGGAGCTGATCTTGG 0: 1
1: 0
2: 0
3: 12
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124219688 Original CRISPR CAGTACCCCTGAGCTTTCGT AGG (reversed) Intronic
905403098 1:37717136-37717158 CAGTATGCCAGAGCTTTCGTAGG - Exonic
909562157 1:77019045-77019067 CAATTCCCCTGAGCTTTGGAAGG + Intronic
922137738 1:222848019-222848041 CAGTACACCTGAGATTTTTTGGG + Intergenic
922894546 1:229090026-229090048 CAGAAGCCCTGGGCTTTCCTGGG + Intergenic
1068904292 10:62306162-62306184 CTCTACCCCTGAGCTATGGTTGG + Intergenic
1069117128 10:64521326-64521348 CAGTAACCCAGAGCTTTCAGGGG - Intergenic
1069513599 10:69059926-69059948 TATTATCCCTGAGCTTTCTTGGG - Intergenic
1077448235 11:2613491-2613513 CCGTGCCCCTGAGCTTGGGTGGG + Intronic
1091699162 12:2648706-2648728 TTTTACCCCTGAGCTTTCCTTGG + Intronic
1093509817 12:19913178-19913200 CAGTGCTCCTGAGCTTTGGAAGG - Intergenic
1106603593 13:31208327-31208349 CAGTTCCCCTGAGCCGTCCTTGG + Intronic
1107261361 13:38495179-38495201 CAGGACACCTGAGATTTCTTTGG - Intergenic
1112340700 13:98550653-98550675 CTGTGTCCCTGAGCTTTCATGGG - Intronic
1121842878 14:97149484-97149506 CAGCACCCCTGAGCCTGCGTGGG + Intergenic
1124219688 15:27838834-27838856 CAGTACCCCTGAGCTTTCGTAGG - Intronic
1125425159 15:39541258-39541280 CATTACACCCGACCTTTCGTTGG - Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1130950305 15:88581350-88581372 AAGTTCCCCTGAGCTTTTGCAGG + Intergenic
1139392093 16:66611578-66611600 CAGTCCCCATGAGCTGTCGCTGG - Intronic
1141592632 16:85078672-85078694 CAGTAACCCTTAGCCTTCCTGGG - Intronic
1142356109 16:89602824-89602846 CAGTACTCCTGGGCTGTGGTGGG - Intergenic
1150473323 17:65455998-65456020 CAGCACCTCTGAGCTTGTGTTGG - Intergenic
1152539664 17:80968626-80968648 CAAGACCCCTGAGTGTTCGTGGG - Intergenic
1158393077 18:57059399-57059421 CACTGCCCTTGAGCTTTCCTAGG - Intergenic
1161324971 19:3659159-3659181 CAGGGCCCCTGAGCTTGAGTGGG - Intronic
1165001592 19:32767828-32767850 CAGAACCCCTGATTTTTAGTGGG - Intronic
929799706 2:45089062-45089084 TTTTACCCCTAAGCTTTCGTTGG - Intergenic
934473899 2:94579986-94580008 CTTTACTCCTGAGCTTTAGTTGG - Intergenic
934941667 2:98507525-98507547 CACTACCCATGAGCTTGGGTGGG - Intronic
948463628 2:238142025-238142047 CAGTCCGCCTGAGCTTTTATGGG + Intronic
1172948925 20:38709750-38709772 CTGTACCCCTCAGCCATCGTGGG - Intergenic
1177039309 21:16087125-16087147 CAGTACGACTTAGCTTTCCTGGG + Intergenic
952090251 3:29876753-29876775 CATTACCCCTGGGCCTTCGCAGG - Intronic
954458004 3:50610498-50610520 CAGTAGCCCTGAGCTTACAAGGG + Exonic
954743286 3:52771554-52771576 TGGCACCCCTGAGCTTTCTTGGG - Intergenic
957523370 3:81349655-81349677 CAGAACCCCTGAGGTCTCATTGG + Intergenic
957624361 3:82640509-82640531 CAGTCTCCCTGAGCTCTCGAGGG + Intergenic
959829155 3:110839699-110839721 CAGGACCTCTGAGCTTTTGGGGG + Intergenic
964377045 3:156058161-156058183 CACTACCCCTGTACTTTCTTTGG - Intronic
968576453 4:1368527-1368549 CAGGACCCCTGGGCTTCAGTGGG - Intronic
969548275 4:7846435-7846457 CAGAACCCCTCAGTTTACGTTGG - Intronic
999149426 5:149417020-149417042 CAGGACCCCAGTGCTTTCCTGGG + Intergenic
1003528652 6:6919692-6919714 CAGAATCCCTGAGCTTACCTTGG + Intergenic
1007628745 6:43260969-43260991 CACTAGCCCTGAGCCTTCTTTGG + Intronic
1015742445 6:136471290-136471312 CAGTACCCCTGGGTTGTCATTGG - Intronic
1017898920 6:158704194-158704216 CAGTGCCCATGAAGTTTCGTGGG + Intronic
1022479173 7:30731912-30731934 CAGTAGGCCTGAGCTTGAGTGGG - Intronic
1030143342 7:106327724-106327746 CAGCAGCCCTGAGCTCTCCTGGG + Intergenic
1035320205 7:158024107-158024129 CACTACCCCAGAGCTTTGCTGGG - Intronic
1037468466 8:19184070-19184092 TAGTCCACCTGAGCTTTCGTGGG - Intergenic
1038447544 8:27614529-27614551 CACAACCCCTGCGCTTTCGACGG - Intronic
1039972401 8:42331291-42331313 CTGTACCCCTGAACGTTTGTGGG - Exonic
1048985995 8:139735312-139735334 CAGTACCCATGAGCATTTGAGGG + Intronic
1051512424 9:17893272-17893294 CAGTCACCCTGAGCTTGTGTTGG + Intergenic
1053684176 9:40506126-40506148 CTTTACTCCTGAGCTTTAGTTGG + Intergenic
1053934146 9:43134412-43134434 CTTTACTCCTGAGCTTTAGTTGG + Intergenic
1054279547 9:63118827-63118849 CTTTACTCCTGAGCTTTAGTTGG - Intergenic
1054297270 9:63341590-63341612 CTTTACTCCTGAGCTTTAGTTGG + Intergenic
1054395290 9:64646098-64646120 CTTTACTCCTGAGCTTTAGTTGG + Intergenic
1054429937 9:65151298-65151320 CTTTACTCCTGAGCTTTAGTTGG + Intergenic
1054500447 9:65870234-65870256 CTTTACTCCTGAGCTTTAGTTGG - Intergenic
1056404904 9:86264135-86264157 CACTAGCCCTGAGCTTTCACAGG - Intergenic
1195889564 X:109677371-109677393 CACTACCCATGAGCATTGGTGGG - Intronic