ID: 1124220537

View in Genome Browser
Species Human (GRCh38)
Location 15:27846758-27846780
Sequence CAGGGAAAGGAATGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1844
Summary {0: 1, 1: 1, 2: 12, 3: 180, 4: 1650}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124220531_1124220537 -6 Left 1124220531 15:27846741-27846763 CCTGAGCACTCTGGACTCAGGGA 0: 1
1: 0
2: 2
3: 29
4: 233
Right 1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG 0: 1
1: 1
2: 12
3: 180
4: 1650
1124220526_1124220537 26 Left 1124220526 15:27846709-27846731 CCAAGGTGAACTGCTCAGGAGGC 0: 1
1: 0
2: 0
3: 18
4: 192
Right 1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG 0: 1
1: 1
2: 12
3: 180
4: 1650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124220537 Original CRISPR CAGGGAAAGGAATGGGGAGG AGG Intronic
900049901 1:588074-588096 TCGGGAGAGGAGTGGGGAGGAGG - Intergenic
900369188 1:2323918-2323940 CAGGGACCTGAATGGGAAGGGGG - Intronic
900457145 1:2782633-2782655 CAGGGAAAGCAATCCTGAGGGGG - Intronic
900581895 1:3413513-3413535 CAGGGCTAGGCTTGGGGAGGGGG + Intronic
900752195 1:4405580-4405602 CAGGGCAAGGAAAGGTGAGTGGG + Intergenic
900879731 1:5372191-5372213 AAGGGAAAGGCAAGGAGAGGTGG + Intergenic
900929729 1:5729016-5729038 CAGGGGTGGGGATGGGGAGGCGG - Intergenic
901018598 1:6245047-6245069 GAGGGAAGGGGAAGGGGAGGGGG - Intronic
901150285 1:7096787-7096809 CAGGCAAACCAATGGGGAGGAGG - Intronic
901295376 1:8157099-8157121 CAGAGGAAGGTGTGGGGAGGGGG - Intergenic
901333932 1:8432249-8432271 CAGGGAAAGGAATCAGGATGGGG - Intronic
901373873 1:8823543-8823565 CATTGAAAGGAATGGGAATGTGG - Intergenic
901493886 1:9610536-9610558 TGGGGAAGGGAGTGGGGAGGAGG - Exonic
901555435 1:10028361-10028383 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
901705889 1:11072731-11072753 CAGGGACAGGAACGGGGCTGGGG + Intronic
901734490 1:11303892-11303914 GAGGGACAGAAATGGGGTGGAGG + Intergenic
902154195 1:14470672-14470694 CAGGAAAAGGAAGGTAGAGGTGG + Intergenic
902165425 1:14567240-14567262 GAGGGAAAGAAATGGGGAAACGG + Intergenic
902165802 1:14570391-14570413 TAGGGATAGGAATTGGGAGGAGG - Intergenic
902388572 1:16089676-16089698 GAGGGGAAGGGAGGGGGAGGGGG + Intergenic
902471506 1:16649784-16649806 CAGTGAGGGGAATGGGGAGAAGG - Intergenic
902487303 1:16757661-16757683 CAGTGAGGGGAATGGGGAGAAGG + Intronic
902563363 1:17292894-17292916 GAGGGAGGGGAATGGGGAAGGGG + Intergenic
902624707 1:17669907-17669929 CAGGGAAAGCCCAGGGGAGGCGG + Intronic
902729173 1:18357373-18357395 TGGGGAAAGGGATGGGGATGAGG + Intronic
902896864 1:19485360-19485382 CAGGGATGGGCAGGGGGAGGGGG + Intronic
903007041 1:20305650-20305672 CAGGGGAAGGTTTGGAGAGGTGG + Intronic
903041357 1:20533166-20533188 CTGGGGCAGGAGTGGGGAGGTGG + Intergenic
903100176 1:21023252-21023274 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
903257502 1:22112718-22112740 CAGGGAAAGGGGTGGGGGGAGGG + Intergenic
903458146 1:23503263-23503285 CGGGGAGAGGGAGGGGGAGGGGG - Intergenic
903661798 1:24983020-24983042 CAGGGAAAGGGATGGAGTGAGGG + Intergenic
903677045 1:25071058-25071080 TAGAGTGAGGAATGGGGAGGGGG - Intergenic
904372585 1:30059276-30059298 CAGGAAAAGGAAAGTGGAAGGGG + Intergenic
904610762 1:31725092-31725114 CAGAGGAAGGAATGTGGAGTAGG + Intergenic
904686820 1:32266689-32266711 GGGGGAAGGGGATGGGGAGGAGG - Intronic
904778186 1:32924831-32924853 CGGGGTAAGGGATGGGGATGTGG + Intergenic
905000377 1:34663590-34663612 CTGGGAAAGGAAGAGAGAGGCGG - Intergenic
905037976 1:34929750-34929772 GAGGGAGAGGAAGAGGGAGGGGG + Intergenic
905197930 1:36295652-36295674 AAGGGAAAGGAAGGGGAAGGGGG - Intronic
905382448 1:37572623-37572645 CAGGGTAAGGTATGGGGGAGAGG - Intronic
905481899 1:38267688-38267710 CAGGGAAGGGAAGAGAGAGGAGG - Intergenic
905623702 1:39472134-39472156 CAGTGAAAAGAATGGTGAGGGGG + Intronic
905686807 1:39914041-39914063 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
905817912 1:40966229-40966251 CTGGGATGAGAATGGGGAGGTGG + Intergenic
905974872 1:42167736-42167758 TAGGGGAAGGAATGGGGCTGAGG + Intergenic
906427019 1:45723970-45723992 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
906664877 1:47614128-47614150 GAGGGAAAGGAATGAGGTTGAGG + Intergenic
906755004 1:48303428-48303450 CAGGGACTGGGAAGGGGAGGAGG - Intronic
906817761 1:48896647-48896669 CAGGGGATGCAATGGGGAGTAGG + Intronic
906826667 1:48988769-48988791 CAGGCATATGAATGGGCAGGTGG + Intronic
907029769 1:51159281-51159303 CTGGGAAAGGAATGGTGGAGAGG - Intergenic
907043923 1:51288065-51288087 CAGGGCAGGGCAGGGGGAGGGGG + Exonic
907178917 1:52553101-52553123 GGGGGGAAGGGATGGGGAGGGGG + Intronic
907297266 1:53463273-53463295 CAGGGACAGGAACAGGAAGGAGG - Intronic
907461155 1:54606390-54606412 CAGGCAGGGGAGTGGGGAGGAGG + Intronic
907666099 1:56434946-56434968 CAGGGAAGGGCATGGGGTAGGGG + Intergenic
907844585 1:58192237-58192259 CAGGGCTAGGAATGGGGAGATGG + Intronic
907886009 1:58592980-58593002 CAGGGATAGGTATGGGAAGGGGG - Intergenic
907894491 1:58672923-58672945 GAGGGCAGGGAATGCGGAGGAGG + Intronic
908017487 1:59858804-59858826 GAAGGAAAGGAAAGGAGAGGAGG + Intronic
908376460 1:63547042-63547064 AGGGAAAAAGAATGGGGAGGTGG - Intronic
908467674 1:64414225-64414247 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
908865432 1:68543621-68543643 CAAGGAAAAACATGGGGAGGAGG - Intergenic
909058541 1:70851520-70851542 GAGGAAAGGGAATGGAGAGGAGG + Intergenic
909230844 1:73087755-73087777 CAGGGAAGGGGAATGGGAGGGGG - Intergenic
909606872 1:77516766-77516788 GAGGGTAAGAAATGGGGAGAGGG + Intronic
909686557 1:78355259-78355281 AAGGGCAAGAAAGGGGGAGGAGG - Intronic
910163052 1:84294426-84294448 CAGGCATGGGCATGGGGAGGTGG - Intergenic
910255764 1:85245788-85245810 GAGGGAAAGCAATGTAGAGGTGG + Intergenic
910321862 1:85955251-85955273 AAGGGGATGGAATGGGAAGGTGG - Intronic
910394058 1:86774294-86774316 CTCAGAAAGGAAAGGGGAGGAGG - Intergenic
910576995 1:88776214-88776236 CAGGGAGGGCAAGGGGGAGGGGG - Intronic
910860843 1:91741330-91741352 CAGGGCAAGGTACGGGGAAGGGG + Intronic
910995837 1:93103753-93103775 CAGTGATAGTAATGGGGTGGGGG + Intronic
911031736 1:93496234-93496256 GAGGAGAAGGAAGGGGGAGGTGG - Intronic
911038298 1:93572391-93572413 CCAGGAAATGAATGGGGAGGAGG + Intronic
911355018 1:96806149-96806171 CAGGGAAGGGAATGGGCATTTGG - Intronic
911571514 1:99523170-99523192 GAGGGAAAGGAAAGTTGAGGTGG - Intergenic
911587274 1:99705219-99705241 CAGGGTGTGGAATGGGGATGTGG - Intergenic
911767924 1:101701660-101701682 GAGGGAGGGGAGTGGGGAGGGGG - Intergenic
912331218 1:108821825-108821847 GAGGGAAAGGGAAGGGGAGAAGG - Intronic
912490093 1:110058034-110058056 CTGGGAAGGGAAAGGGGAAGTGG - Intronic
912491467 1:110065000-110065022 AAGGGAAAGGAAGGGGGAGGCGG - Intronic
912511584 1:110193647-110193669 CAGGGAAAGGGTTGGGGTGTAGG - Intronic
912529195 1:110307887-110307909 AAGGGCCAGGAGTGGGGAGGGGG - Intergenic
912674457 1:111664569-111664591 CAGGGAGAGGAAGGGGGTGTAGG - Intronic
912703393 1:111894997-111895019 CAGGGGGAGGGAAGGGGAGGAGG + Intronic
913022981 1:114805350-114805372 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
913034046 1:114943760-114943782 CAGGGACAGGAATTGGGAAGAGG - Intronic
913133393 1:115863583-115863605 CAGGTAAAGGTTTGGGGATGTGG + Intergenic
913204402 1:116523375-116523397 AAGGGAAAGGAAGGGAGAGGAGG + Intronic
913253702 1:116935098-116935120 CATTGAAGGGTATGGGGAGGTGG - Intronic
913675930 1:121140083-121140105 CAGGGCGAGGTATGGGGAAGGGG - Intergenic
913997358 1:143662176-143662198 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
914027826 1:143928023-143928045 CAGGGCGAGGTATGGGGAAGGGG - Intergenic
914464450 1:147913727-147913749 CAGGGAAAGGAGAGAAGAGGAGG - Intergenic
914848026 1:151293471-151293493 TAGGGGCAGGAATGGGGAGGAGG + Intronic
914916095 1:151820126-151820148 CAGGGGAAGGAGGGGGGAGCAGG - Intronic
915100900 1:153499208-153499230 CCTGCAAAGGACTGGGGAGGAGG - Intergenic
915112619 1:153574470-153574492 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
915145488 1:153793903-153793925 TGGGGATAGGAGTGGGGAGGGGG + Intergenic
915163391 1:153934686-153934708 CAGGGAAAGGCATAGAGAGTTGG - Intronic
915345706 1:155195833-155195855 CAGGGAAGGGTGTGAGGAGGAGG - Exonic
915492263 1:156257607-156257629 TAGGGGAAGACATGGGGAGGGGG - Intronic
915514684 1:156405987-156406009 CTGGCAAAGGTAGGGGGAGGAGG - Intronic
915543631 1:156583652-156583674 CTGGGAAAGGCATGGGGATGGGG + Intronic
915543636 1:156583697-156583719 CAGGAAAGGGAGGGGGGAGGGGG - Intronic
915684076 1:157613610-157613632 CTGGGAAAGGAAGGGGAATGAGG + Intergenic
915749916 1:158197088-158197110 CAGGGGAAGTAATGGGGGAGGGG - Intergenic
915916043 1:159941672-159941694 GAGGGCAAGGCAAGGGGAGGTGG - Intronic
915923730 1:159999475-159999497 CAGGGCATGGAAAGAGGAGGTGG - Intergenic
916087666 1:161282406-161282428 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
916863973 1:168836746-168836768 GAGGGAGGGGAAGGGGGAGGGGG - Intergenic
916925323 1:169513395-169513417 CAGGGAAAGGAATGATGAAAGGG + Intergenic
916956568 1:169842797-169842819 TAGGGGAAGAGATGGGGAGGTGG - Intronic
917136095 1:171789336-171789358 CAGGGAAGGGAGTGGTGAGAGGG + Intronic
917463657 1:175255110-175255132 CATAGATAGGAATGGGGAGAGGG + Intergenic
917639929 1:176973651-176973673 GAGGGAGAAGATTGGGGAGGAGG - Intronic
917789841 1:178492471-178492493 CAGAAAAGGGAATGGGGAGCAGG + Intergenic
917881569 1:179342242-179342264 AAGGGAAGGGAATGGGGTGGGGG - Intronic
917925369 1:179785165-179785187 CAGGGTGAGGAATGGGGGGTGGG - Intronic
918139956 1:181711777-181711799 AGGGGGAAGGAATAGGGAGGAGG + Intronic
918904877 1:190478649-190478671 CAAGGAGAGGAATAGGGAGAAGG - Intergenic
919056946 1:192583037-192583059 AAGGGAAAGGAAAAGGGAGATGG + Intergenic
919465395 1:197918231-197918253 CAGGGAGAGGAACTGGGAGGAGG + Intronic
919496795 1:198282713-198282735 CAGAGAAAGAAAGGGGGAAGTGG + Intronic
919530846 1:198717795-198717817 AAGGGAAGGGAGTGGGGAAGAGG - Intronic
919741872 1:200985801-200985823 AAGGGAAAGGAAGGGAGGGGAGG - Intronic
919751217 1:201039442-201039464 TGGGGAAGGGACTGGGGAGGGGG + Intergenic
919763467 1:201112371-201112393 AAGGGAAAGCACTGGGGTGGGGG - Exonic
919847614 1:201651400-201651422 GAGGGGCAGGAGTGGGGAGGAGG + Intronic
919860356 1:201735930-201735952 AAGAGAAAGGAATTGGGAGAGGG - Intronic
920056023 1:203192415-203192437 CAGGGCGAGGTATGGGGAAGGGG + Intergenic
920111644 1:203591368-203591390 CAGAGAGAGGAATTGGGGGGCGG + Intergenic
920365746 1:205447580-205447602 CAGGGGAAGGAATGTGGGAGTGG + Intronic
920463300 1:206158920-206158942 CAGGGCGAGGTATGGGGAAGGGG - Intergenic
920656039 1:207875843-207875865 GAGGGAAAGGATTGGGGAAAGGG - Intergenic
921013650 1:211167615-211167637 CTGGCAAAGTAATGGGGAGAGGG + Intergenic
921053610 1:211527956-211527978 CAGCGAAGGGGCTGGGGAGGAGG - Intergenic
921119804 1:212126639-212126661 AAGGGAAAGGCTTGGGGAGAAGG - Intergenic
921518521 1:216128901-216128923 TGGGGAAGGAAATGGGGAGGGGG - Intronic
921568146 1:216745591-216745613 AAGGGAAAGGAGGGGGCAGGGGG - Intronic
921729078 1:218556480-218556502 GGGGGAAAGGAATGGGGGGAAGG - Intergenic
921961589 1:221040850-221040872 GAGTGAAAGGAATGAGGTGGAGG + Intergenic
921969338 1:221129202-221129224 CATGGGAAGGAAGGAGGAGGAGG + Intergenic
922754684 1:228089137-228089159 AAGGGGCAGGAATTGGGAGGAGG + Intronic
923039323 1:230308589-230308611 CAGGGCTAGGGGTGGGGAGGCGG + Intergenic
923043175 1:230334142-230334164 CAAGGAAAGGAATTCGGAAGAGG - Intronic
923051310 1:230393054-230393076 GAGGGATAGGAAGGGGAAGGCGG + Intronic
923150596 1:231229832-231229854 GAGGGAGGGGAATGGGGAGCTGG + Intronic
923401839 1:233623276-233623298 CTGGGAAGGGTACGGGGAGGGGG + Intronic
923505345 1:234600421-234600443 CACGGGAAGGAAAGGGGAGGAGG - Intergenic
923589051 1:235302234-235302256 AGGGGAAAGAGATGGGGAGGGGG + Intronic
923589698 1:235308445-235308467 TAGGGAGAGGGAGGGGGAGGGGG - Intronic
924453056 1:244197017-244197039 CAGGGAACAGAATGGGGGTGCGG - Intergenic
924475750 1:244380821-244380843 CAGGAAAAGGGAGGGAGAGGTGG + Intronic
924824750 1:247527406-247527428 CAGAGAAAGCAATGAGGAAGTGG - Intronic
1062824572 10:558302-558324 CAGGGTCAGGAAGCGGGAGGTGG - Intronic
1062887826 10:1032491-1032513 GAGGGACAGGCAGGGGGAGGGGG - Intergenic
1063050218 10:2439080-2439102 CATGGAAAGGAGTTGGGGGGTGG + Intergenic
1063084846 10:2806983-2807005 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1063131883 10:3185446-3185468 AAGGGAATGGAGTGGGAAGGTGG - Intergenic
1063395593 10:5684800-5684822 AAGGAAAAGAAAAGGGGAGGGGG - Intergenic
1063473490 10:6307956-6307978 GAGAGAAAGGAATGGGGAAGGGG - Intergenic
1063704434 10:8417197-8417219 CAAGGAAAGGAAGATGGAGGTGG - Intergenic
1063744762 10:8868374-8868396 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1064108840 10:12520936-12520958 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1064220514 10:13436754-13436776 CAGGGGTAGGGATGAGGAGGTGG - Intergenic
1064288925 10:14015404-14015426 CAAGGAAGGGAAGGGGAAGGAGG - Intronic
1064642741 10:17430947-17430969 CAGGGAAAGGAAAGGGGTTTGGG - Intronic
1064989531 10:21243931-21243953 AAGGGAAAGGGAAGGGGAAGGGG + Intergenic
1065188488 10:23191505-23191527 CGGAGAAAGGAATGGGGAGACGG - Intergenic
1065548295 10:26844520-26844542 CAGGGAAGGGAAGAGGGAAGAGG - Intronic
1065590794 10:27259204-27259226 CTGGGAGAGAAAAGGGGAGGGGG - Intergenic
1065669822 10:28103844-28103866 AAGCCATAGGAATGGGGAGGAGG + Intronic
1065795943 10:29308419-29308441 CTATGAAAGGAATGGGGTGGAGG - Intronic
1066334632 10:34463208-34463230 AAGGGAAAGAAAAGGGGAAGGGG + Intronic
1066706329 10:38183042-38183064 CAGGGAAAAGGGTGGGAAGGGGG - Intergenic
1067007932 10:42682241-42682263 CAGGGCAAGGTATGTGGAGAGGG - Intergenic
1067655042 10:48185447-48185469 GAGGGATAGGAAAGGGGAGTAGG + Intronic
1067680042 10:48428457-48428479 CTGGGAAAGGAAAGGGGACTGGG + Intronic
1067682050 10:48447613-48447635 CAGGGGCAGCAGTGGGGAGGTGG - Intronic
1067794873 10:49313681-49313703 AAGGGAAAGGCACTGGGAGGAGG + Intronic
1067904377 10:50275530-50275552 CTGGAAAAGCAATGGGGAGCAGG + Intergenic
1068022739 10:51605043-51605065 GAGGGGATGGAATGGGAAGGTGG + Intronic
1068411943 10:56667603-56667625 AGGGGAAAGGGAGGGGGAGGGGG - Intergenic
1068506265 10:57903418-57903440 CAGGGGAAGGAATTGTGGGGAGG + Intergenic
1068535829 10:58240698-58240720 CATGGAGCGGAATGGGAAGGTGG + Intronic
1068956075 10:62819181-62819203 CAGGGAATGGAGTGGGGGCGGGG + Intronic
1069302770 10:66928545-66928567 GAGGGAGAGGGAAGGGGAGGGGG - Intronic
1069623618 10:69853017-69853039 CGGGGGGAGGTATGGGGAGGGGG + Intronic
1069755901 10:70774391-70774413 CAGGGACAGGAAGGGGGCTGGGG - Intronic
1069915241 10:71783134-71783156 CAGGAAATGGAATGGAGAGAAGG - Intronic
1069973949 10:72198026-72198048 AAGGGAAGGGAAGGGGGAGCAGG + Intronic
1070028201 10:72651686-72651708 AAGGGAGGGGAAGGGGGAGGAGG + Intergenic
1070331880 10:75423328-75423350 AAAGGAAAGGAAAGGGGAAGGGG - Intergenic
1070367850 10:75753460-75753482 CAGGGAGCTGAATGGTGAGGAGG + Intronic
1070513407 10:77181307-77181329 CAGGGAAATCGATGGGGAAGGGG - Intronic
1070596644 10:77837463-77837485 CAGGGAAAGGAAGGGAGCTGTGG - Intronic
1070797266 10:79223918-79223940 CAGGCCAAGGAATTGGGGGGAGG + Intronic
1070979744 10:80634516-80634538 CAGGGATACTAATGGGGGGGAGG + Intronic
1070998217 10:80805522-80805544 TAAGGAAAGGAATGTGGAGTGGG - Intergenic
1071176473 10:82932116-82932138 CAGGTGAAGGAATGGAGAGAAGG - Intronic
1071195421 10:83153596-83153618 AAGGGAATGGAATGGGAAGATGG - Intergenic
1071276938 10:84064143-84064165 GAGGAAAAGGAAGGGAGAGGAGG - Intergenic
1071487816 10:86114343-86114365 CAGGGAAGGCAGTGGAGAGGTGG + Intronic
1071550608 10:86563672-86563694 TAGGGAATGGAAAGGGGAGTGGG + Intergenic
1071867773 10:89755566-89755588 AAGGGAAAGGGAAGGGGAAGGGG - Intronic
1071938813 10:90563525-90563547 CAGGGAAAGTAGTGGAGAGAGGG - Intergenic
1071963913 10:90833010-90833032 CAGGGAAGAGGATGGGGTGGAGG + Intronic
1072076161 10:91976218-91976240 CAAGGCAAGGTATGGGGATGAGG + Intronic
1072197802 10:93131579-93131601 CAGGGAAACGCCTGGGCAGGTGG - Intergenic
1072206822 10:93212218-93212240 GACGCAAAGGCATGGGGAGGCGG - Intergenic
1072268159 10:93750531-93750553 CTGGGAAGGGTAGGGGGAGGTGG - Intergenic
1072491717 10:95913101-95913123 CTGGGAAAGGTATTGGGTGGGGG - Intronic
1072587074 10:96792170-96792192 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1072662664 10:97372185-97372207 CAAGGAGAGGGATGGGGAGCTGG + Intronic
1072810567 10:98458168-98458190 AAAGGACAGGAATGGGGCGGGGG - Intronic
1072887604 10:99292946-99292968 CAAGGAAGGGTTTGGGGAGGCGG - Intergenic
1072908453 10:99477283-99477305 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1073060052 10:100728552-100728574 AAGATAAAGGCATGGGGAGGGGG - Intergenic
1073186562 10:101618690-101618712 TGGGGAAAGGGGTGGGGAGGTGG - Intronic
1073450491 10:103606465-103606487 GAGGGAAGGGGAGGGGGAGGGGG - Intronic
1073450495 10:103606471-103606493 GAGGGAGAGGGAAGGGGAGGGGG - Intronic
1073597767 10:104817549-104817571 AAGGGAGAGGAGGGGGGAGGGGG - Intronic
1073597821 10:104817671-104817693 AAGGGAAAAGAAAGGGGAAGAGG - Intronic
1073849917 10:107602928-107602950 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1074494240 10:113965073-113965095 GAGAGAAGGCAATGGGGAGGAGG + Intergenic
1075213883 10:120515236-120515258 CAGGGACTGGAATGGGGAGCTGG + Intronic
1075849475 10:125575378-125575400 GAGGGAATGGGTTGGGGAGGTGG - Intergenic
1075924270 10:126237449-126237471 CAGTGAGAGGAAGGGGGAGCGGG - Intronic
1076081633 10:127586880-127586902 CTGGTAGAGGAATGGGGAAGTGG - Intergenic
1076131175 10:128014892-128014914 CTGGGAATGGGATGGGGTGGGGG + Intronic
1076245098 10:128940991-128941013 CAGAGACAGAAATGGGGAGATGG - Intergenic
1076361678 10:129894072-129894094 CAGGAACAGGACTGGGGAGCAGG - Intronic
1076661214 10:132057111-132057133 CGGGGAAAGGAATGGGGGCTGGG + Intergenic
1076666812 10:132097911-132097933 AAGGGGAAGGAAAGGGGAAGGGG - Intergenic
1076757591 10:132581019-132581041 CAGGGAAAGGTATGGGGGAGGGG - Intronic
1076916786 10:133426582-133426604 TGGGAAAAGGAAGGGGGAGGCGG + Intergenic
1076936889 10:133571382-133571404 TGGGAAAAGGAAGGGGGAGGCGG + Intergenic
1077091263 11:779397-779419 GGGGAAGAGGAATGGGGAGGGGG - Intronic
1077210577 11:1369351-1369373 CAGGGAAGGGAAGGGAGAGGAGG + Intergenic
1077392547 11:2306837-2306859 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1077423012 11:2461743-2461765 CAGAGGAAGGGATGGGCAGGTGG + Intronic
1077521400 11:3037517-3037539 CAGGGAAAGGCCTGAGGAAGAGG + Intronic
1077552308 11:3206130-3206152 CAGGGAAATGAAAAGGGAAGGGG - Intergenic
1077839489 11:5960234-5960256 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1077894362 11:6442803-6442825 GAGGGAAAGAAAAGGTGAGGGGG - Intergenic
1078367714 11:10720501-10720523 CATGGAAGGCAATGGGGAAGTGG - Intergenic
1078600325 11:12724778-12724800 CAAGGAAAGGAGGGGCGAGGAGG - Intronic
1078784572 11:14476291-14476313 CAAGGAAAGGAATGAAGAAGAGG - Intronic
1078807945 11:14725491-14725513 GGGGGAAGGGAAGGGGGAGGGGG - Intronic
1078864820 11:15287700-15287722 AAGGTAAAGGTATGGGGAGGTGG + Intergenic
1078878467 11:15423003-15423025 CTGGGAAAGGAATGGGTCGGGGG + Intergenic
1079080552 11:17410686-17410708 TAGGGAAAGGCATGGTGGGGAGG + Intronic
1079091790 11:17485854-17485876 CATGGAAAATAATGGGGTGGAGG + Intergenic
1079365200 11:19802970-19802992 CCTGGAAAGGAATGGAAAGGAGG - Intronic
1079372187 11:19861032-19861054 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1079381753 11:19944507-19944529 AAGGGAAAGGAAAGGGGAAAGGG - Intronic
1079413475 11:20210994-20211016 AAGGGAAAGGAGTGGGCAGTGGG + Intergenic
1079485906 11:20935769-20935791 GAGGGTGAGGAATGGAGAGGAGG + Intronic
1079594461 11:22224994-22225016 CAGGAAAGGGAAGGGGAAGGAGG + Intronic
1079968594 11:27008196-27008218 CATGGAAAGGAAAGGGTAGAGGG + Intergenic
1080302913 11:30804396-30804418 CAGGGCAAGGTATGGGGAAAGGG - Intergenic
1080756638 11:35206639-35206661 CAGAGAAAGGAAGTGGGTGGTGG + Intronic
1080833247 11:35916031-35916053 CAGGGAAGGAAGTGGGGAGGTGG + Intergenic
1080947996 11:36996557-36996579 CAGCTCAAGCAATGGGGAGGAGG + Intergenic
1081114197 11:39177738-39177760 AAGGGAAAGGGAAGGGGAAGAGG + Intergenic
1081304994 11:41501290-41501312 CTGGGAAAGGAACTGGGAAGTGG + Intergenic
1081481080 11:43489750-43489772 AAAGGAAAGGAGGGGGGAGGGGG + Intronic
1081531088 11:43959830-43959852 CGGGAAGAGGAATGGGGTGGGGG - Intergenic
1081631458 11:44692690-44692712 CAGGGAGAGGCCTGGGGTGGGGG + Intergenic
1081771354 11:45652144-45652166 GAAGGGAAGGAGTGGGGAGGGGG - Intronic
1081865438 11:46357252-46357274 GTGGGCAAGGAAAGGGGAGGAGG - Intronic
1082174663 11:49047016-49047038 AAATTAAAGGAATGGGGAGGAGG - Intergenic
1082717445 11:56632023-56632045 CAGGAAGAAGAATGGGGAGATGG + Intergenic
1082762101 11:57136938-57136960 GAGGAAAAGGAAGGAGGAGGAGG + Intergenic
1082791574 11:57349602-57349624 CAGGGAAAGGAAAGAGGGGAGGG + Intronic
1082802161 11:57423116-57423138 CAGAGAAAGCAAGTGGGAGGTGG - Intronic
1083022547 11:59521687-59521709 AAGGGAAAGGGAAGGGGAAGGGG + Intergenic
1083024424 11:59537988-59538010 CAGGGAAAGGAAGGGTGAGCTGG - Intergenic
1083074922 11:60027145-60027167 GAGGAAAAGGAATGTGGGGGCGG - Intergenic
1083170636 11:60922241-60922263 CAGGGCAAGAAAAGGGCAGGGGG - Exonic
1083356411 11:62069528-62069550 CAGGGAAATGAGTTAGGAGGAGG + Intergenic
1083398377 11:62406816-62406838 CAGGGAAAGGATAGAGGAAGAGG + Intronic
1083697654 11:64453463-64453485 CAGGTAAAGGAGGGGGCAGGAGG + Intergenic
1083701151 11:64478424-64478446 CAGGGGAAGGGAAGTGGAGGAGG + Intergenic
1083967041 11:66049289-66049311 AGGGGAAAGGAAGGGGGACGGGG + Intergenic
1084471760 11:69365746-69365768 GAGGGTGAGGAGTGGGGAGGAGG + Intronic
1084672832 11:70617455-70617477 CGAGGAACGGAGTGGGGAGGTGG + Intronic
1084920327 11:72464437-72464459 AAGGGAAGGGGAGGGGGAGGAGG - Intergenic
1084920329 11:72464443-72464465 GAGGGAAAGGGAAGGGGAGGGGG - Intergenic
1084952078 11:72671992-72672014 CAGGGAAGGGAATGTCTAGGTGG - Intronic
1084953100 11:72677440-72677462 CAGGGAGAGGGATGGGCAGCAGG - Intergenic
1084978945 11:72818384-72818406 AAGGGACAGGAATAGGGAGGAGG - Intronic
1085020227 11:73202073-73202095 CAGGGGAAGGGGTGGGGATGAGG - Intergenic
1085085573 11:73664416-73664438 AAGGGGAAGGGAGGGGGAGGGGG - Intergenic
1085085602 11:73664474-73664496 AAGGGAAGGGGAAGGGGAGGGGG - Intergenic
1085095332 11:73755787-73755809 AAAGGAAAGGAAGGGGGAGGTGG + Intronic
1085199361 11:74692284-74692306 CTGGGAAGGGTATGGGGAGCGGG + Intergenic
1085259198 11:75194555-75194577 CAGAGAATGAAAGGGGGAGGAGG - Intronic
1085360310 11:75878887-75878909 CAGGGACAGGGACAGGGAGGGGG + Intronic
1085360314 11:75878893-75878915 CAGGGACAGGGAGGGGGAGGGGG + Intronic
1085443534 11:76583371-76583393 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1085448544 11:76617083-76617105 CTGGGAAAGGAAGGGAGGGGAGG - Intergenic
1085712003 11:78837593-78837615 CAGGGAAGGAAGTGGGCAGGTGG + Intronic
1085745605 11:79111815-79111837 CAGAGAAAGGAGGTGGGAGGGGG + Intronic
1085850958 11:80119430-80119452 AAGGGAGAGAAATGAGGAGGAGG - Intergenic
1085923611 11:80988681-80988703 CAGGGGAAGGAGTGGGAGGGAGG + Intergenic
1085927042 11:81035061-81035083 CAGGGAAAGGAAAGGGGAAAGGG + Intergenic
1086421620 11:86643310-86643332 GAGGGAAAGTCATGGGTAGGGGG - Intronic
1086518773 11:87646120-87646142 AAGGGAAGGGAAGGGGGAAGGGG - Intergenic
1086691114 11:89789072-89789094 AAAATAAAGGAATGGGGAGGAGG + Intergenic
1086714688 11:90050583-90050605 AAAATAAAGGAATGGGGAGGAGG - Intergenic
1086823324 11:91463838-91463860 TAGGGAAGGAAATGGGGAGATGG - Intergenic
1087254150 11:95935973-95935995 CACGGAAAGGAAAGGGGAAAGGG + Intergenic
1087396614 11:97609134-97609156 CAGGGAGATGGATGGGGAGCTGG + Intergenic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1087487172 11:98770781-98770803 GAGGGAGGGGAAGGGGGAGGGGG + Intergenic
1087509923 11:99078794-99078816 AAGGGAGTGAAATGGGGAGGGGG + Intronic
1087942430 11:104115043-104115065 CAGGGAAGAGGGTGGGGAGGGGG - Intronic
1088256936 11:107911781-107911803 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1088392601 11:109331340-109331362 CAGGGACAGTGATGGAGAGGAGG + Intergenic
1088474502 11:110221156-110221178 GGGGAAAAGGAATGGGGAGAGGG + Intronic
1088562717 11:111132087-111132109 AAGGGGAAGAGATGGGGAGGTGG + Intergenic
1088728995 11:112664217-112664239 CAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1088750195 11:112836523-112836545 GAGGGGAAGGAATGGCAAGGTGG - Intergenic
1088771036 11:113036423-113036445 CAGGCAATGGAATGGGGGAGAGG - Intronic
1089061625 11:115630546-115630568 GATGGAAAGGAATGGGGTGATGG + Intergenic
1089321630 11:117630432-117630454 CAGGGAAAGGCATGGGAGAGAGG + Intronic
1089678678 11:120107499-120107521 GAGGCAAAGGAGTGGGGAGGGGG - Intergenic
1089681978 11:120123680-120123702 AAGAGAAAGGAATGGGGTGGAGG - Intronic
1089792133 11:120953016-120953038 CTGGGAACTGCATGGGGAGGGGG + Intronic
1090255803 11:125283289-125283311 CAGGGAAATGAATGGGTAAGTGG + Intronic
1090268153 11:125367820-125367842 CAGAGAGAAGAAAGGGGAGGTGG - Intronic
1090276518 11:125423777-125423799 CAGGGATGGGGATGGGGAGGAGG + Intronic
1090458083 11:126866838-126866860 AGGGGAATGGAATGGGAAGGTGG - Intronic
1090505381 11:127306910-127306932 AAGGGAAAGGGAAGGGGAAGGGG - Intergenic
1090648034 11:128781853-128781875 AAGGGAAAGAGATGGGGAGAGGG - Intronic
1090686506 11:129128580-129128602 CGGGGAGAGGGAGGGGGAGGGGG - Intronic
1090744206 11:129693680-129693702 AAGGGGAAGGAAAGGGGAAGGGG + Intergenic
1090787314 11:130061167-130061189 AAGGGAAAGGGAAGGGGAAGGGG + Intergenic
1091177503 11:133575032-133575054 CATGGAAAGGAGTGGGGGTGGGG - Intergenic
1091184907 11:133638378-133638400 GAGGGAAGGGAAGGGGAAGGTGG - Intergenic
1091273473 11:134333610-134333632 CAGGAAAAGGTATGCGAAGGAGG + Intronic
1091371162 11:135059461-135059483 TAGGGTGAGGAATGGGGAAGAGG + Intergenic
1091546235 12:1503113-1503135 CAGAGCAAGGCAGGGGGAGGAGG + Intergenic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1091603103 12:1929843-1929865 GAGGAGAAGGAAGGGGGAGGAGG + Intergenic
1091629200 12:2146557-2146579 TTGGGAAAGGTGTGGGGAGGCGG + Intronic
1092092161 12:5812216-5812238 AAGGGAAGGGAAGGGGGAAGGGG + Intronic
1092274127 12:7046490-7046512 TGAGGAAAGGAATGGAGAGGAGG - Intronic
1092528862 12:9327741-9327763 CAGGGCAAGGGATGGCGATGAGG + Intergenic
1092877220 12:12858787-12858809 GAGGCAAAGGGATGGGGAGGAGG - Intergenic
1093323980 12:17749981-17750003 CAGGGAAAGGAACTGGCATGTGG + Intergenic
1093420300 12:18967151-18967173 CAAGGTTAGAAATGGGGAGGAGG - Intergenic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1094017920 12:25884319-25884341 GCGGGGAAGGCATGGGGAGGAGG + Intergenic
1094216944 12:27952439-27952461 CAGGGAAAGGGGGAGGGAGGGGG + Intergenic
1094412598 12:30182918-30182940 AAGGGAATGGAGTGGGAAGGTGG - Intergenic
1094497307 12:30996332-30996354 CAGGGCAGGGTATGGGGAGCAGG - Exonic
1094555702 12:31497822-31497844 CAGGGAGGGGCAAGGGGAGGGGG + Intronic
1094670541 12:32564019-32564041 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1095393906 12:41741471-41741493 TAGGGAAAGAAATGTGGAGATGG - Intergenic
1095667829 12:44822930-44822952 CAAAGAAAGGCAGGGGGAGGAGG + Intronic
1095685552 12:45029523-45029545 CAGGGAAAGAAGTGGGAAAGTGG + Intronic
1095808792 12:46349824-46349846 AAGGGAAATGAATTGGAAGGGGG + Intergenic
1095868378 12:46997789-46997811 CAGGGAAAGTTGTGGGGTGGGGG + Intergenic
1095955601 12:47803979-47804001 CTGGGTAGGGACTGGGGAGGTGG - Intronic
1095958005 12:47817649-47817671 CAGGGAATGGCAGGCGGAGGGGG - Intronic
1096006871 12:48180633-48180655 AAGGGAAAGGGAAGGGGAAGGGG - Intronic
1096101109 12:48970957-48970979 TAGGGAGAGGGATAGGGAGGAGG + Intronic
1096177903 12:49535186-49535208 CAGGGAGGGGAATGTTGAGGAGG - Intergenic
1096214622 12:49792403-49792425 AAGGGAAAGGACTCGGGAGCAGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096913619 12:55009308-55009330 CAGGGAAGAGAAAAGGGAGGGGG + Intergenic
1096983480 12:55742524-55742546 CTGGGAAAGGGGTGGGGGGGGGG - Intergenic
1097110230 12:56652431-56652453 GAGGGAAGGGGAGGGGGAGGGGG + Intergenic
1097146381 12:56942268-56942290 CAGGGAAAGGAATGGAGACTTGG - Intergenic
1097166190 12:57087843-57087865 CAGGGAAAGGAGGGGGGGTGGGG - Intronic
1097196992 12:57248314-57248336 CAGAGAAATGAATGGGATGGAGG + Intronic
1097376074 12:58844459-58844481 GAGGGAAAGGAAGGGGAAGAAGG + Intergenic
1097526419 12:60741549-60741571 CAGGAAAAGAATTGGGGAGAGGG - Intergenic
1097587945 12:61537303-61537325 CAGGGAAAGGATTGTGGAATTGG - Intergenic
1097779376 12:63686122-63686144 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1097806255 12:63967933-63967955 CCAGGAAGGGAATGGTGAGGAGG + Intronic
1098412418 12:70201118-70201140 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1098525167 12:71479538-71479560 AAGTGAAAAGAATGGAGAGGAGG + Intronic
1098846723 12:75546149-75546171 CAGGAAAGGGAATTGGGAGGAGG + Intergenic
1098995028 12:77109504-77109526 CAAGGAAAGGAATGAGGGAGGGG + Intergenic
1099021285 12:77407682-77407704 CAGGTAAAGGAATTAGGAGAGGG - Intergenic
1099330051 12:81273320-81273342 CAGGGAACGGAGTGGGGTGGTGG - Intronic
1100525504 12:95415682-95415704 AAAGGAAAGTAGTGGGGAGGAGG - Intergenic
1100581833 12:95946627-95946649 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1100891062 12:99126497-99126519 CAGGGTAAGGTGGGGGGAGGGGG - Intronic
1101384499 12:104244824-104244846 CAGGGAAAAGAAAGGGGTGTAGG + Intronic
1101964804 12:109275103-109275125 CAGGGAAAGGAATAAGAAGATGG - Intergenic
1102066330 12:109979175-109979197 CAGAAAAAGGAAGGAGGAGGAGG + Intronic
1102167273 12:110816624-110816646 CAGTGACTGGGATGGGGAGGTGG + Intergenic
1102167860 12:110820762-110820784 CAGGGGGAGGGAAGGGGAGGGGG - Intergenic
1102205508 12:111088111-111088133 CAGGGAATGGAGTGGGAATGGGG + Intronic
1102207344 12:111099505-111099527 CAGGGCAAGTTGTGGGGAGGTGG + Intronic
1102230351 12:111257570-111257592 GAGGGAGAGGAAAGAGGAGGAGG - Intronic
1102717398 12:114986267-114986289 AAGGGAAAGGGGTGGGGAAGAGG - Intergenic
1102745273 12:115244104-115244126 CAGGGAGAGGAAGGGAGAGAGGG + Intergenic
1102920014 12:116784856-116784878 CAGGGAAAAGAATGAAGTGGAGG - Intronic
1102983732 12:117262467-117262489 GAGGGAGAGAAAGGGGGAGGGGG + Intronic
1103219490 12:119231966-119231988 GAGGGAAAGGGATAGAGAGGAGG - Intergenic
1103248784 12:119481748-119481770 AAGGGAAAGGGGTGGGAAGGAGG - Intronic
1103623186 12:122201019-122201041 CAGGTCACGGGATGGGGAGGAGG + Intronic
1103776704 12:123371681-123371703 AAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1103899248 12:124295033-124295055 CGGGGAGAGGAAGGGGGAGGAGG + Intronic
1104052229 12:125203228-125203250 CAGGGGAAGGGATGGGGACAAGG - Intronic
1104066829 12:125313558-125313580 AGGGGAAAGGAGAGGGGAGGGGG - Intronic
1104316347 12:127706123-127706145 CGGGGAGGGGAAGGGGGAGGAGG - Intergenic
1104411118 12:128558693-128558715 CACTGAAAGGAAGAGGGAGGTGG - Intronic
1104546216 12:129715214-129715236 CAGAGAAAGGTAAGGGGAGGAGG + Intronic
1104765896 12:131330043-131330065 CAGATAAATGAATGGGGAGATGG - Intergenic
1104813345 12:131631645-131631667 CAGATAAATGAATGGGGAGATGG + Intergenic
1104813373 12:131631827-131631849 CAGATAAATGAATGGGGAGATGG + Intergenic
1105287032 13:19012883-19012905 CAGGGAAGGGATATGGGAGGTGG - Intergenic
1105367512 13:19778383-19778405 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1105404427 13:20121566-20121588 CAGGGCAAGGTATGAGGTGGGGG + Intergenic
1105518197 13:21109357-21109379 CCGTGAAAGGCATGTGGAGGTGG - Intergenic
1105546089 13:21352101-21352123 GAAGGTAAGGAATGGGGAGAAGG - Intergenic
1105578608 13:21674337-21674359 CAGGGAAAGGAGTGGGGGTGGGG + Intronic
1105613976 13:21995854-21995876 CAGGGAAAGGAAAGTACAGGAGG + Intergenic
1106299757 13:28453018-28453040 AAAGGAAAGGAAAGGGGAGGGGG - Intronic
1106415624 13:29543696-29543718 GAGGGAGAGGGGTGGGGAGGAGG + Intronic
1106463815 13:29995283-29995305 TTGGGGAAGGAATGTGGAGGGGG - Intergenic
1106956580 13:34943976-34943998 CAGGGAAAGAAATGGAAAGAAGG + Intronic
1106993176 13:35448750-35448772 CAGAGAAGGGAATGGGGTGGTGG + Intronic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1108156387 13:47589698-47589720 CAGGAAAAGGGATGGGGAGTTGG + Intergenic
1108159060 13:47618908-47618930 CAGCGGAAGGGATGGGGAGTTGG - Intergenic
1108392053 13:49956259-49956281 GGGGGAGGGGAATGGGGAGGAGG - Intergenic
1108396631 13:49996893-49996915 AGGGGAAAGGGAGGGGGAGGGGG + Intronic
1108396644 13:49996916-49996938 AGGGGAAAGGGAGGGGGAGGGGG + Intronic
1108401239 13:50046487-50046509 AAGGGAAAGGAAAGGGGAAAGGG - Intergenic
1108750131 13:53439885-53439907 GAGGGGGAGGGATGGGGAGGGGG - Intergenic
1108938047 13:55911000-55911022 CCGTAAAAGGAGTGGGGAGGAGG - Intergenic
1109003594 13:56838104-56838126 AATGGATAGGAATGGGGAGAAGG + Intergenic
1110536010 13:76651570-76651592 TTGGGAAAGGAAAGGGGAAGTGG + Intergenic
1111139297 13:84093293-84093315 CAGGGAAGGGAAGAGGGTGGTGG + Intergenic
1111306131 13:86414926-86414948 AGGGGAGAGGACTGGGGAGGAGG - Intergenic
1111405086 13:87793391-87793413 CAGTGAGATGAATGGGGAGCTGG + Intergenic
1111519539 13:89382633-89382655 CAGGGGAAGAAATGGGGAAAGGG - Intergenic
1111692412 13:91580711-91580733 CATGGCAAGGAATAGGAAGGTGG - Intronic
1112025398 13:95406677-95406699 GAGGGAAGGGAGTGGGCAGGGGG + Intergenic
1112354970 13:98666531-98666553 CAGAGCAGGTAATGGGGAGGGGG + Intergenic
1112676591 13:101709039-101709061 AAGGGAAAGAATTGGGGAGAAGG + Intronic
1112819186 13:103310999-103311021 TGGGGAAAGAAAGGGGGAGGGGG + Intergenic
1112976860 13:105330419-105330441 CTGAGAAAGGAATGAGGAGGGGG + Intergenic
1113072405 13:106434397-106434419 CAGGTGAAGGAAAGGGGAAGAGG - Intergenic
1113147232 13:107220825-107220847 CAGAGAGAGGAGTGGGGTGGAGG + Intronic
1113541758 13:111115116-111115138 CGGGGAAGGGAAAGGGGAAGGGG - Intronic
1113647210 13:112006969-112006991 CAGGGAGGGGGAGGGGGAGGGGG + Intergenic
1113673969 13:112195787-112195809 GAGGGGAAGGAGGGGGGAGGAGG - Intergenic
1113927368 13:113949206-113949228 CAGTGAAGAGAGTGGGGAGGTGG - Intergenic
1114197987 14:20495715-20495737 CAGGGAGAGGAAGGAAGAGGAGG - Intergenic
1114226977 14:20747478-20747500 CAGGGAAAGGAATTTTAAGGTGG + Intronic
1114380193 14:22194854-22194876 CAGTGAAGGCAATGGGGACGGGG + Intergenic
1114630410 14:24155876-24155898 GAGGGAAAGGAAAGGGGAGGAGG + Intronic
1115121948 14:29947500-29947522 CAGCTAAAGGAATGGTGAGAGGG + Intronic
1115942341 14:38622985-38623007 ACGGGAGAGGAATGGGGACGGGG + Intergenic
1116201404 14:41802288-41802310 CAGGGATGGGAATTGGGAGATGG + Intronic
1116273823 14:42805403-42805425 CAGGGAGAGGAAAGGGGAAAGGG + Intergenic
1116655044 14:47641887-47641909 CAAGGATAGGAATGGAGAAGAGG + Intronic
1116731207 14:48624533-48624555 CAGAGAAAGGAATGAGCTGGGGG + Intergenic
1116790655 14:49336346-49336368 AAGGGACAGGACTGGGGTGGAGG + Intergenic
1116825355 14:49668274-49668296 AAAGGAAAGGAAAGGGAAGGAGG + Intronic
1117092377 14:52264183-52264205 AAGAGCAAGGAATGGAGAGGAGG - Intergenic
1117412772 14:55465935-55465957 AAGGGAGAGGAATGGGGCTGAGG - Intergenic
1117920670 14:60723171-60723193 GGGGGAGAGGAAGGGGGAGGAGG + Intronic
1117967574 14:61221495-61221517 GAGAGAAAAGAATGGGGAGGGGG - Intronic
1117993035 14:61453634-61453656 CAGGGAAGGGGAAGGGGAAGGGG - Intronic
1118780519 14:69004817-69004839 GAGGGAAAGGAAGGGGAGGGAGG - Intergenic
1119093027 14:71801885-71801907 AAGGGAAGGGAATGGGGAAAGGG + Intergenic
1119182167 14:72612592-72612614 CAGGGAAGGGAGAGGGCAGGAGG + Intergenic
1119208634 14:72812928-72812950 TAGGGATAGGAATGGGGTTGGGG + Intronic
1119320285 14:73726390-73726412 CAGGGATGGGAATGGACAGGAGG + Intronic
1119422660 14:74516803-74516825 CAAGGTAAGGAACGGGAAGGAGG - Exonic
1119485598 14:74984775-74984797 CAGCGGAAGGAGTGGGGATGGGG + Intergenic
1119552245 14:75523384-75523406 CAAGGAAATGAATGAGGAGGTGG + Intronic
1119684042 14:76616162-76616184 TAGGGCAAGGCATGGGGAAGGGG + Intergenic
1119707480 14:76793323-76793345 GAAGGAAAGGAAAGGGGAGACGG + Intronic
1119718320 14:76874320-76874342 GAGGGAGAGGTATGGGGAGCTGG + Intergenic
1119750759 14:77075830-77075852 CAGGGAAGCGGATGGGGAGCAGG - Intergenic
1119779019 14:77265969-77265991 CAGGGAAGGGAAGGGGGACCTGG - Exonic
1119931437 14:78551576-78551598 AAGGGAAATGAGAGGGGAGGAGG - Intronic
1119959421 14:78837622-78837644 CAGGGACAGGCATGGGGGTGGGG - Intronic
1119977958 14:79046201-79046223 GAAGGAAAGGAAAGGAGAGGAGG - Intronic
1120073902 14:80134321-80134343 CAGGGCAAGGTATGGGGAAAGGG - Intergenic
1120170713 14:81245243-81245265 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1120187396 14:81408063-81408085 CAAGGAAAAGAATGTGGAAGAGG - Intronic
1120415645 14:84215394-84215416 GAGGGGATGGAATGGGAAGGTGG + Intergenic
1120565534 14:86051000-86051022 CAGGGAGAGGGAAGAGGAGGCGG - Intergenic
1120937923 14:89916731-89916753 CAAGGAGAGGAAGGGGCAGGAGG - Intronic
1121266699 14:92608000-92608022 CAGGGCTAGTGATGGGGAGGGGG + Intronic
1121457631 14:94048790-94048812 CAGATACAGGAGTGGGGAGGGGG + Exonic
1121593282 14:95137218-95137240 AGGGGAAAGGAAAGGGGAAGAGG + Intronic
1121624457 14:95374167-95374189 CAGGGCAAGGCATGGGGAAAGGG + Intergenic
1121908069 14:97765576-97765598 CAGGGAAAGGCATCAGGAGTTGG + Intergenic
1122030460 14:98908096-98908118 CAAGGGAAGGAAGGGGCAGGTGG - Intergenic
1122047488 14:99034419-99034441 AAGGGGAAAGAAAGGGGAGGGGG + Intergenic
1122161844 14:99790819-99790841 CAGGGAAAGGAAATGGGGGGAGG - Intronic
1122169542 14:99860795-99860817 GAGGGATGGGAAGGGGGAGGGGG - Intronic
1122171606 14:99880511-99880533 GAAGGAAAGGAGTAGGGAGGTGG + Intronic
1122447869 14:101782131-101782153 GAGAGAGAGGGATGGGGAGGGGG - Intronic
1122955986 14:105071525-105071547 CAGGGCAAGGTATGGGGATGCGG + Intergenic
1123495464 15:20819783-20819805 GAGGGAGAGGAATGGGAAGTTGG + Intergenic
1123551952 15:21388897-21388919 GAGGGAGAGGAATGGGAAGTTGG + Intergenic
1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG + Intronic
1124348032 15:28935330-28935352 CAAGGATGGGAATGGGGAGTGGG + Intronic
1124416336 15:29475645-29475667 AATGGAAAGAAATGAGGAGGAGG + Intronic
1124659960 15:31539201-31539223 AAGGGAAAGGAATTGGGGTGTGG - Intronic
1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG + Intronic
1125262759 15:37846623-37846645 CAGGGAGAAGAATGGTCAGGAGG - Intergenic
1125601540 15:40918329-40918351 CAGGGCATGGGGTGGGGAGGGGG + Intergenic
1125680583 15:41527831-41527853 CAGGGATAGGAATGGGGCTTGGG - Intronic
1125697676 15:41652368-41652390 CGGGGAAAGGAGAGGGGAGAGGG - Intronic
1125800900 15:42445929-42445951 CAAGGAAGGGAGTGTGGAGGTGG + Intronic
1126355194 15:47787986-47788008 CAGGGAAGAGAAGCGGGAGGAGG + Intergenic
1126473954 15:49046576-49046598 AAGGAAAAGGAGTGGGGAGGAGG + Intergenic
1126528768 15:49688840-49688862 CAGGACAGGGAATGGGGAAGTGG - Intergenic
1126542817 15:49840981-49841003 CAGGGAAAGGAAAAGGGAAAGGG + Intergenic
1126780815 15:52137614-52137636 CAGGGAAAGACATGGGGACAGGG + Intronic
1126928046 15:53612905-53612927 GAGGGAAAGGAAGGTTGAGGGGG + Intronic
1126955326 15:53927310-53927332 CAGGGAATGGACTGGAGAGGAGG + Intergenic
1127015505 15:54681784-54681806 AAAGGGAAGGAATGGGGAAGTGG + Intergenic
1127091969 15:55476175-55476197 AAGGGCAGGGCATGGGGAGGTGG + Intronic
1127138780 15:55952817-55952839 GAGGGAAAGTCAAGGGGAGGAGG - Intronic
1127174089 15:56335499-56335521 CTGGGAAGGGTATGGGGATGGGG + Intronic
1127298069 15:57627371-57627393 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1127307961 15:57726750-57726772 CAGGGGATAGAATGGGGTGGTGG + Intronic
1127584078 15:60365854-60365876 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1127637989 15:60889333-60889355 CAGGGAAGGGAGTGGGGCGGGGG + Intronic
1127654774 15:61045766-61045788 AAAGGAATGGAATGGGGAGTAGG - Intronic
1127975050 15:63990934-63990956 CAGGCAGAGGAGTAGGGAGGGGG - Intronic
1128062271 15:64742618-64742640 CAGGGAAAGGGGTGTGGCGGGGG + Intronic
1128080536 15:64854507-64854529 CAGGGAGTGGGATGGGGACGGGG - Intronic
1128151721 15:65367370-65367392 AAGAAAAAGGAATGGGGAGAGGG + Intronic
1128249106 15:66152380-66152402 CAGTGAGAGGAAGGGTGAGGAGG - Intronic
1128292769 15:66490677-66490699 CAGAGACAGGCATGGGAAGGAGG - Exonic
1128322717 15:66704111-66704133 CACGGAAGGGGATGGGGACGGGG - Intronic
1128392272 15:67190380-67190402 TAGGGAAAGGGGTGGGGTGGGGG - Intronic
1128506162 15:68274352-68274374 CAGGGAAAGGCAAGGAGAGTGGG + Intergenic
1128606355 15:69039280-69039302 TAGGGAAGGAGATGGGGAGGAGG + Intronic
1128609529 15:69062902-69062924 TAGGGAAAGGAATGAGAAGGAGG - Intergenic
1128673879 15:69594907-69594929 CTTGGAAATGAATGGGAAGGAGG + Intergenic
1128701936 15:69811094-69811116 CAGGGGAAGGAAGGGTGAGATGG - Intergenic
1128705024 15:69832296-69832318 AAGGAAAAGGAAAGGGGAAGGGG + Intergenic
1128789488 15:70422735-70422757 CAGGAAAAGAAAAGGGGAGGTGG - Intergenic
1128797645 15:70477309-70477331 ATGGGGAGGGAATGGGGAGGGGG - Intergenic
1128944411 15:71811277-71811299 GAGGGCAAGGAATGGGGGTGGGG + Intronic
1128981857 15:72194019-72194041 GTGGGAAAGGAAGGAGGAGGGGG - Intronic
1129039904 15:72676796-72676818 AGGGGTTAGGAATGGGGAGGTGG + Intronic
1129054334 15:72808094-72808116 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1129082617 15:73053203-73053225 TCAGGAAAGGAAAGGGGAGGGGG + Intronic
1129248010 15:74291737-74291759 TAGGGGATGGAATGGGTAGGAGG + Intronic
1129384017 15:75185778-75185800 GAGGGAAGGGAGTGGGGATGGGG + Intergenic
1129430559 15:75498375-75498397 AGGGGTTAGGAATGGGGAGGTGG + Intronic
1129453396 15:75663178-75663200 GAGGGAAAGGAATGGGGTTGGGG - Intergenic
1129657471 15:77533750-77533772 CTGGGGAAGGGAAGGGGAGGAGG - Intergenic
1129692436 15:77721411-77721433 CAGGGAAGGGCTTTGGGAGGAGG - Intronic
1130032569 15:80328911-80328933 CAGGGATGGGGATGGGGAGGTGG + Intergenic
1130226104 15:82059185-82059207 GAGGAAGAGGAGTGGGGAGGAGG - Intergenic
1130288097 15:82572087-82572109 GAGGGAAAGGGAGGGGCAGGAGG - Intronic
1130513523 15:84608161-84608183 GAGGGAAAGGAAGAGGGAGTAGG - Intronic
1130555607 15:84920453-84920475 AAAGGAAAGGAAAGGGGAAGGGG + Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130657063 15:85799131-85799153 CAGGGTCAGGAACAGGGAGGTGG - Intergenic
1130688831 15:86062671-86062693 CAGGAGAAGGAAAGAGGAGGAGG - Intergenic
1131007126 15:88987324-88987346 GAGGGAATTGAATGTGGAGGAGG - Intergenic
1131071841 15:89471042-89471064 GAAGGGAAGGGATGGGGAGGAGG + Intergenic
1131397990 15:92101953-92101975 CAGGGAGAGGGATGGCGATGGGG - Intronic
1131755077 15:95550738-95550760 AAGCCAAGGGAATGGGGAGGGGG - Intergenic
1131978825 15:97975224-97975246 GAGGGAAGGAAATGGAGAGGAGG - Intergenic
1131990274 15:98086445-98086467 GAGGGAGAGGAAAAGGGAGGAGG + Intergenic
1132156020 15:99495634-99495656 CAGGGACAGAGATGGAGAGGGGG + Intergenic
1202960298 15_KI270727v1_random:116114-116136 GAGGGAGAGGAATGGGAAGTTGG + Intergenic
1132481502 16:168547-168569 CTGGCACAGGAAAGGGGAGGAGG - Intergenic
1132643844 16:989858-989880 AAGGGAAGGGAAGGGGGAGCTGG + Intergenic
1132664656 16:1076023-1076045 GAGGGAGAGGGAGGGGGAGGTGG - Intergenic
1132664702 16:1076133-1076155 GAGGGAGAGGGATGGGGAGGCGG - Intergenic
1132826338 16:1907467-1907489 CAGGGAAGGGAAGGGGAAGCCGG - Intergenic
1133002018 16:2856571-2856593 CAGGGTAAGGAAAGAGGGGGAGG - Intronic
1133021943 16:2970553-2970575 CAGGGAGAGGTCTGGGGAGATGG + Intronic
1133330151 16:4967951-4967973 AAGGGAGGGGAAGGGGGAGGGGG - Intronic
1133365219 16:5203739-5203761 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1133459217 16:5972505-5972527 CTGGGAAAGGGAAGGGGAGTTGG + Intergenic
1133494642 16:6305405-6305427 CAGGAAAAAGAAGGAGGAGGAGG - Intronic
1133568850 16:7022054-7022076 AAAGGAAAGGAAAGGGGAGGGGG - Intronic
1133586931 16:7204755-7204777 AAGAGAAAGGATTGGGGAGAGGG - Intronic
1133644563 16:7752109-7752131 GGGGGAAAGGAATAGAGAGGTGG - Intergenic
1133908119 16:10039766-10039788 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1133982042 16:10640130-10640152 GAGGGGAAGAAAGGGGGAGGAGG - Intronic
1134222166 16:12363348-12363370 CATGGAAAGGAAGAGGGAAGTGG - Intronic
1134228612 16:12411745-12411767 CAGAGAAAGGAACAAGGAGGAGG + Intronic
1134268442 16:12711922-12711944 CAGGGAAGAGACAGGGGAGGAGG + Intronic
1134363457 16:13554341-13554363 CAGGGAAGGGCATGGGGATAAGG + Intergenic
1134389592 16:13807192-13807214 CAGGGAAAGCTTTGGGGATGAGG - Intergenic
1134755115 16:16660238-16660260 CAGGGCAAGGTATGGGGAGAGGG + Intergenic
1134774115 16:16837087-16837109 GGGGGAAAGGAGAGGGGAGGGGG + Intergenic
1134777381 16:16864975-16864997 CAGGGGAAGGGGTAGGGAGGAGG - Intergenic
1134849939 16:17471040-17471062 GAGGGAAAGGAAGGGGGTGGGGG + Intergenic
1134884190 16:17775396-17775418 CAGGAAGATGAATGGGGAGGAGG - Intergenic
1134990948 16:18698935-18698957 CAGGGCAAGGTATGGGGAGAGGG - Intergenic
1135244081 16:20839401-20839423 TAGGGAAAGCAAGGGAGAGGAGG - Intronic
1135496733 16:22958412-22958434 CAGACAGAGGAGTGGGGAGGAGG - Intergenic
1135587180 16:23679907-23679929 CTGGAGAAGGAATGGGGTGGGGG + Intronic
1135641971 16:24127612-24127634 CATGGAAAGGATTGGGGTTGGGG + Intronic
1135708696 16:24696762-24696784 AAGGGAAGGGAAAGGGGAGGGGG + Intergenic
1135741192 16:24976555-24976577 AAGGGAAAGGAAAGGGGAAAGGG + Intronic
1135931843 16:26744722-26744744 CAGGGAGAGGAAATGGGATGAGG + Intergenic
1135934805 16:26770625-26770647 GAGGGAAGGGAAGGTGGAGGAGG + Intergenic
1136197962 16:28667019-28667041 GTGGGAGAGGAAGGGGGAGGGGG + Intergenic
1136259029 16:29061041-29061063 GTGGGAGAGGAAGGGGGAGGGGG + Intergenic
1136428595 16:30184606-30184628 GAGGCAGAGGTATGGGGAGGAGG + Intronic
1136487621 16:30583417-30583439 CAGGGATGGGAATGAGGAGAAGG - Exonic
1136661291 16:31765546-31765568 CAGGGAAAGGAAAGGGGAAAGGG - Intronic
1137000132 16:35222123-35222145 CAGGGGCAGGAAAGGGGAGGAGG - Intergenic
1137055119 16:35741924-35741946 CAGGGAATGGAAAGAGGAGTTGG + Intergenic
1137232354 16:46578174-46578196 AAGGGAAAGGAAAAGGGAGAGGG + Intergenic
1137240974 16:46654149-46654171 GAGGGAGAGGAAGGGAGAGGGGG + Intergenic
1137241863 16:46662242-46662264 CACGGACAAAAATGGGGAGGAGG - Exonic
1137270486 16:46899663-46899685 CAGGGAAATGAGGTGGGAGGAGG + Intronic
1137381668 16:48004977-48004999 ATGGAAAAGCAATGGGGAGGAGG + Intergenic
1137394772 16:48109114-48109136 CAGGCAAAGGAATGCAGAGATGG + Intronic
1137512567 16:49114590-49114612 ATGGGAAAGGAAAGTGGAGGAGG - Intergenic
1137523201 16:49211222-49211244 GAGGGAGAGGGACGGGGAGGGGG + Intergenic
1137552122 16:49444798-49444820 CAGGGCCTGAAATGGGGAGGTGG + Intergenic
1137552243 16:49445604-49445626 TAGGGCATGAAATGGGGAGGTGG - Intergenic
1137689691 16:50414353-50414375 AAGGGAAAGGGTTGGTGAGGAGG - Intergenic
1137788280 16:51154285-51154307 CCGGGAAAGGAGATGGGAGGTGG + Intergenic
1137947726 16:52750936-52750958 AAGGGAGAGGAAGGGAGAGGAGG + Intergenic
1138026069 16:53523451-53523473 GAGGGAAGGGAGTGGGGAGGAGG - Intergenic
1138102010 16:54259753-54259775 CATTGAAAGGAAGGTGGAGGTGG + Intronic
1138253606 16:55530458-55530480 CAGGGAAGGGAGTGGTGAGATGG - Intronic
1138339540 16:56279600-56279622 CAGGGAAGGAAAAGGGAAGGAGG - Intronic
1138532015 16:57639695-57639717 GAGTGAAAGGGACGGGGAGGAGG - Intronic
1138568913 16:57855101-57855123 AAAAGAAAGAAATGGGGAGGGGG - Intronic
1138594403 16:58022150-58022172 CAGGGAAAGGTGTGGGGAGAGGG + Intergenic
1139226321 16:65235961-65235983 CTGAGAAAGGGGTGGGGAGGAGG - Intergenic
1139310154 16:66021311-66021333 CAGGGAAGGTATTGGGAAGGTGG - Intergenic
1139352017 16:66342836-66342858 CAGGAAGAGGAACGGGGAGGTGG - Intergenic
1139701553 16:68710961-68710983 GAGGGGAAGGAGGGGGGAGGGGG + Intronic
1139762889 16:69201440-69201462 AATGGAAAGGATTAGGGAGGCGG + Intronic
1139944179 16:70627455-70627477 GAGGGGAGGGAAGGGGGAGGAGG - Intronic
1140045964 16:71440912-71440934 CTTGGCAAGGAATGGGGAGTTGG - Intergenic
1140281133 16:73556303-73556325 GAACGAAAGGAGTGGGGAGGGGG + Intergenic
1140545420 16:75803796-75803818 AAGAGGAAAGAATGGGGAGGAGG - Intergenic
1140655124 16:77132337-77132359 AGGGGAAGGGAATGGGGAGGGGG - Intergenic
1140655142 16:77132375-77132397 AGGGGAAGGGGATGGGGAGGGGG - Intergenic
1140726796 16:77820891-77820913 CAGGGAAACTACTGGGGAAGGGG - Intronic
1140771012 16:78204048-78204070 CAGGGACAGGAATGGTGAGAAGG + Intronic
1140857728 16:78992609-78992631 CATGGGAAGGGATGGGGAGCTGG - Intronic
1140858341 16:78997673-78997695 GAGGGAAAGGAAGGGAGGGGAGG - Intronic
1140903624 16:79392373-79392395 GAAGGAAAGGAAAGGGAAGGAGG + Intergenic
1141311431 16:82917078-82917100 CAGGAAAAGTTATGGGGAGTGGG + Intronic
1141456132 16:84144040-84144062 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1141523868 16:84598887-84598909 CAGTCAAAGGGATGGGGATGTGG + Intronic
1141710073 16:85693503-85693525 CAGGGGAAGGAAGGGGAAGTGGG - Intronic
1141728907 16:85808996-85809018 GAGGGAAAGGGAGAGGGAGGGGG + Intergenic
1141845221 16:86603892-86603914 GAAGGAAAGGAAGGAGGAGGAGG - Intergenic
1141970836 16:87481514-87481536 CAGGGAGAGAAACGGGGGGGGGG + Intronic
1142011628 16:87718344-87718366 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1142160445 16:88554812-88554834 CAGCGGAAGGAGTAGGGAGGAGG - Intergenic
1142218824 16:88842833-88842855 CAGGGAAGAGCACGGGGAGGAGG + Intronic
1142267632 16:89071819-89071841 TCGGGAAAGGAACCGGGAGGGGG - Intergenic
1142290668 16:89192490-89192512 CAGGGGACGGCCTGGGGAGGAGG - Intronic
1142556024 17:778073-778095 CAGGGCAGGGCATGGGGAGTGGG - Intronic
1142605537 17:1079040-1079062 GAGGGAAGGGGAAGGGGAGGAGG + Intronic
1142609472 17:1100706-1100728 CAGGGAAAGGCCTGGAGATGAGG - Exonic
1142813256 17:2406370-2406392 AAAGGACATGAATGGGGAGGTGG - Intronic
1142825148 17:2506250-2506272 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1142855884 17:2730022-2730044 GATGGGAAGGACTGGGGAGGTGG + Intergenic
1143129157 17:4665243-4665265 CAAGGGCAGGGATGGGGAGGTGG - Intergenic
1143161854 17:4877176-4877198 GAGAGAAAGAAATTGGGAGGTGG - Intronic
1143259971 17:5591477-5591499 GAAGGAAAGGAAAGGAGAGGAGG - Intronic
1143282742 17:5766931-5766953 CAGGAAAAAGGATAGGGAGGTGG - Intergenic
1143473866 17:7192190-7192212 GAGGGAAAGGAAAGGGAAGATGG + Intronic
1143540958 17:7568676-7568698 CAGGGAAAGGTACCGGGAAGAGG - Intronic
1143575836 17:7792585-7792607 GAGGGAAAGGAAGTGGGAGTTGG + Intronic
1143798765 17:9359959-9359981 GAGGGACAGGAGTGGGGAGAAGG + Intronic
1143965815 17:10755940-10755962 AAGGAAAAGGAGGGGGGAGGGGG - Intergenic
1143974334 17:10819148-10819170 AGAGGAAAGGAATGGGGAGATGG - Intergenic
1143979812 17:10859001-10859023 CAGAGGCAGGAATGGGTAGGAGG - Intergenic
1144244869 17:13352931-13352953 CCAGGGAAGGACTGGGGAGGAGG - Intergenic
1144552802 17:16256422-16256444 GAGGCAGAGGAATCGGGAGGTGG - Intronic
1145011664 17:19371772-19371794 CAGGGAAGGGGAAGGGGTGGGGG + Intronic
1145088962 17:19970487-19970509 CTGGGAAAGGAAGGGTCAGGTGG - Intronic
1145312615 17:21708747-21708769 CAGGGGAAGGATAGGGGAGAGGG + Intergenic
1145399198 17:22517405-22517427 CAGGGAGAGGACTGGGGGAGGGG - Intergenic
1145728085 17:27152503-27152525 CAAGGAAGGGAATGGGGGGATGG + Intergenic
1145902114 17:28496067-28496089 CAGGGACTGGGGTGGGGAGGTGG - Intronic
1145988572 17:29064194-29064216 CAGTGAAGAGAATGGGGAAGTGG + Intergenic
1146375136 17:32288764-32288786 CAGGAAATGGAGTGGGGAGAGGG - Intronic
1146444684 17:32923811-32923833 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1146488400 17:33262301-33262323 TAGGGAAGGGAATGGGGAGAGGG + Intronic
1146786505 17:35726261-35726283 TCTGGAAAGAAATGGGGAGGGGG + Intronic
1146825487 17:36018976-36018998 TAGGGAAAGGCATGGGGAGTGGG + Intergenic
1146926930 17:36751710-36751732 CAAGGACAAGAATGGGGATGAGG - Intergenic
1147138970 17:38451103-38451125 CTGGGAAAGGAATGTGGGGTGGG - Intronic
1147167919 17:38603189-38603211 CAGGGAAGGGAGGGGGGAGAGGG + Intronic
1147187137 17:38719243-38719265 CCAGGAAAGGAATTGGGCGGTGG + Intronic
1147330417 17:39696037-39696059 CAGGGAAGGGAAAGGGGTGCTGG - Intronic
1147516372 17:41121798-41121820 AAGGGAAAGGGAAGGGGAAGGGG + Intergenic
1147906055 17:43823917-43823939 GAGAGCAAGGTATGGGGAGGTGG - Exonic
1147917967 17:43900037-43900059 AAGGAACAGGAGTGGGGAGGAGG + Intronic
1147930429 17:43977176-43977198 CAGGGAGAGGGAGGGGGAGAGGG + Intronic
1147972899 17:44229343-44229365 CATGGAAACCACTGGGGAGGGGG + Intergenic
1148020175 17:44548156-44548178 CAGGAAAGGGGAAGGGGAGGGGG + Intergenic
1148202235 17:45756796-45756818 GAGGGACAGGGATGGGGAGAGGG + Intergenic
1148240582 17:45997237-45997259 CAGGGACAGGAATGGGGAAAGGG - Intronic
1148396052 17:47309018-47309040 AAGGGAAAGAAAAGGAGAGGAGG - Intronic
1148553888 17:48566370-48566392 TGGGGAAAGGGAAGGGGAGGGGG + Intronic
1148622777 17:49046850-49046872 CTGGGAAAGGAATGGGAGGGTGG - Intronic
1148778643 17:50109753-50109775 GAGGGAGAGGGAGGGGGAGGAGG - Intronic
1149170275 17:53801380-53801402 CATGGAGAGAAAGGGGGAGGAGG + Intergenic
1149310846 17:55391562-55391584 CAGGGATACAAATGAGGAGGTGG + Intergenic
1149376168 17:56046355-56046377 CTGGGAAAGGAATGCTGGGGAGG + Intergenic
1149526802 17:57362690-57362712 GAGGGAAAAGAATGGGGGGAAGG - Intronic
1149534426 17:57421525-57421547 GAGGAGAATGAATGGGGAGGAGG - Intronic
1149536962 17:57440736-57440758 CAGGGTAAGGACTGAGGAGGTGG + Intronic
1149612465 17:57967633-57967655 GAGGGAGAAGAATGGGGAGGGGG - Intergenic
1149632843 17:58141787-58141809 GAGGGAGAGGAAGAGGGAGGGGG - Intergenic
1149751797 17:59153710-59153732 CAGGGAATGGCGTGGGAAGGAGG + Intronic
1150082684 17:62254313-62254335 CAGGGAAAAAAAAGGGGTGGGGG + Intergenic
1150441116 17:65192274-65192296 CTGGGAAGGGAAGGGGGAAGGGG + Intronic
1150673577 17:67223977-67223999 CAGGGAAGGGAATGGGTATTTGG - Intronic
1150685322 17:67316079-67316101 AAGGGAAGGGAAAGGGGAAGGGG - Intergenic
1150811409 17:68360042-68360064 TAGGGGAAGGAATGGGGACTCGG + Intronic
1151007119 17:70450426-70450448 AAGGGAAAGAAGTGGGGAGTGGG + Intergenic
1151248778 17:72817332-72817354 GAAGGAAAAGAAGGGGGAGGGGG + Intronic
1151374719 17:73679355-73679377 CTGGGATAGGAATGGGAATGGGG - Intergenic
1151827091 17:76529675-76529697 CAGGGAAAAGACAGGGGAAGAGG - Intronic
1152013733 17:77736036-77736058 AAGAGAGAGGAGTGGGGAGGTGG + Intergenic
1152018900 17:77770348-77770370 TGGGGAAAGGAAAGGAGAGGAGG - Intergenic
1152019926 17:77775664-77775686 GAGGGAAGGGGAGGGGGAGGGGG - Intergenic
1152019930 17:77775670-77775692 GAGGGAGAGGGAAGGGGAGGGGG - Intergenic
1152028080 17:77824635-77824657 CAGGGCCAGGAATGAGGAGAAGG + Intergenic
1152129433 17:78467077-78467099 CAAAGGAAGGAATGGGGAGTGGG + Intronic
1152167201 17:78717368-78717390 CCTGGAAAGGAATGGTGATGGGG - Intronic
1152197157 17:78924757-78924779 GAGGGAAAGAAAGGGAGAGGAGG + Intronic
1152324021 17:79625148-79625170 CAGGGAGAGGGAGGAGGAGGAGG - Intergenic
1152332925 17:79684166-79684188 CAGGGAATGAAACTGGGAGGCGG + Intergenic
1152482623 17:80565373-80565395 AAGGCAAAGGGAAGGGGAGGTGG + Intronic
1152535619 17:80948965-80948987 CACAGAGAGGAATGGGGCGGAGG + Intronic
1152665528 17:81566670-81566692 CAGAGAAAGGCCGGGGGAGGAGG + Intronic
1152705026 17:81838907-81838929 CAGGGAAAGGTATGGACAGTTGG + Intergenic
1152859079 17:82685204-82685226 AGAGGAAAGGAATGGGGAGGGGG + Intronic
1152898869 17:82928705-82928727 CTGGGGAAGAGATGGGGAGGGGG - Intronic
1153006958 18:505421-505443 AAGAGACAGGAATGGGAAGGAGG - Intergenic
1153028221 18:690069-690091 CAGGGCAAGGTGTGAGGAGGGGG - Intronic
1153254816 18:3160126-3160148 AAGGGAAAGGAAGGAGGAGGAGG - Intronic
1153282164 18:3424859-3424881 TAGGGCAAGGTATGGGGAAGGGG - Intronic
1153989368 18:10382509-10382531 AAGGGAAGGGGATGGGGAGATGG - Intergenic
1154045711 18:10902943-10902965 CAAGGAATTGAATGGGGAGCTGG + Intronic
1154375218 18:13803413-13803435 CAGGGCAAGGAATCAGGTGGAGG + Intergenic
1154388241 18:13914566-13914588 AAGGGATAGGAATGGGAAAGGGG - Intronic
1154452867 18:14492258-14492280 GAGGGAGAGGAATGGGAAGTTGG + Intergenic
1155048958 18:22129994-22130016 AAGGGAAGGGAAAGGGGAAGGGG - Intergenic
1155071804 18:22323533-22323555 GCGGGAAGGGAATGGGGAGTTGG - Intergenic
1155135322 18:22985991-22986013 CAGGGAAGGGACTGGGGGGAGGG - Intronic
1156220909 18:35051166-35051188 CAGGGAGAGAGATGGGGTGGGGG - Intronic
1156487880 18:37478106-37478128 CAGGGAGAGGAGAGGAGAGGGGG - Intronic
1156718826 18:40045337-40045359 CCGGGACAGGGGTGGGGAGGGGG - Intergenic
1156810642 18:41245926-41245948 CTGGGAAAGGAAGGAGGTGGGGG - Intergenic
1156849346 18:41708113-41708135 CAGAAAAAGGGGTGGGGAGGGGG + Intergenic
1157171386 18:45409633-45409655 CTGGGAAAGGGGTGGGTAGGAGG - Intronic
1157217983 18:45801647-45801669 CTGGGAAAGGAATGGAAGGGAGG - Intergenic
1157470270 18:47983138-47983160 GGGGGGAAGGAAAGGGGAGGAGG - Intergenic
1157556805 18:48618117-48618139 CAGGGCAAGGAATGGTGTGCTGG - Intronic
1157595131 18:48859652-48859674 GGGAGAAAGAAATGGGGAGGAGG + Exonic
1157701604 18:49764365-49764387 CAGGGCCTGGAGTGGGGAGGGGG + Intergenic
1157729505 18:49991224-49991246 CAGGCAAAAGCATGGGGAGCTGG + Intronic
1157776784 18:50402256-50402278 CGGGGTAAGGGATGGGGATGAGG - Intergenic
1157965933 18:52208114-52208136 GTAGGATAGGAATGGGGAGGAGG - Intergenic
1158158925 18:54457753-54457775 CAGGGCAATGACTGGGGAGGTGG + Intergenic
1158806772 18:60983242-60983264 GAGGGACAGGGATGGGGAGAAGG + Intergenic
1158840435 18:61380307-61380329 CGTGGAAAGAAAAGGGGAGGAGG + Intronic
1159258249 18:65976751-65976773 AAGGAAATGGAATGGGAAGGTGG + Intergenic
1159915379 18:74183123-74183145 CGGGGAGAGGAAGGGAGAGGTGG - Intergenic
1160002047 18:75033864-75033886 CAGGGAAAGGAGAAGGGAAGAGG - Intronic
1160110724 18:76027407-76027429 CTGGGAAGGGTATTGGGAGGTGG + Intergenic
1160141929 18:76332120-76332142 AAGGGAAAGGAAGGGGAAGGGGG + Intergenic
1160228582 18:77029430-77029452 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1160383383 18:78477976-78477998 GGGGGCAAGGAACGGGGAGGTGG - Intergenic
1160429461 18:78801473-78801495 CAGGGACAAAAATGGGGAGTTGG + Intergenic
1160896456 19:1404593-1404615 GAAGGAAATGAATGGGGAAGAGG + Intergenic
1160965728 19:1746176-1746198 GAGGGGCAGGAAGGGGGAGGAGG + Intergenic
1161141835 19:2652690-2652712 GAGGGAAAGGAAGGGGGAGATGG + Intronic
1161160106 19:2757089-2757111 ATGGGAAAGGAGTGGGGAGCAGG + Intronic
1161524167 19:4743143-4743165 CAGGGATAGGGATGGGGAGCAGG + Intergenic
1161600883 19:5181984-5182006 TAGGGTTAGGAATGGGGTGGGGG - Intronic
1161718908 19:5892570-5892592 CATGGGAAGGAAGGGGGATGAGG + Exonic
1161837803 19:6659812-6659834 CGGGGTAAGGGATGGGGATGAGG + Intergenic
1162089542 19:8269966-8269988 CAGGTGAAGGAAAAGGGAGGGGG + Intronic
1162099312 19:8330272-8330294 CAGGGGAAGGTCTGGAGAGGTGG + Intronic
1162324661 19:9991925-9991947 CATGGAAGGGAATAGGGATGTGG + Intronic
1162450805 19:10753390-10753412 GGGGGAAGGGAAGGGGGAGGGGG - Intronic
1162594022 19:11613156-11613178 AAAGGAAAGGAGAGGGGAGGGGG - Intronic
1162791783 19:13066791-13066813 CAGGGTGAGGAATGGAGAGAAGG + Intronic
1163106525 19:15125860-15125882 CAATGAAAGGCAAGGGGAGGCGG - Intergenic
1163166184 19:15499712-15499734 AAGGGAAAGGATTGGGGAGAAGG - Intergenic
1163176870 19:15570225-15570247 CAGGGAGAGGGATGGAGAGTTGG + Intergenic
1163213901 19:15862425-15862447 GAGGGAAGGGGAGGGGGAGGGGG + Intergenic
1163482363 19:17564890-17564912 AGGGGAGAGGAATGGGGAGTTGG - Intronic
1163562309 19:18026932-18026954 GAGAGCCAGGAATGGGGAGGTGG + Intergenic
1163633320 19:18427726-18427748 CAGGGAAAGGAAGGTGGTGAGGG - Intronic
1163779541 19:19239352-19239374 GAGGGAAAGGAAGGAGGAGGAGG - Intronic
1163786546 19:19277654-19277676 AAGGGGTGGGAATGGGGAGGCGG + Intronic
1163847015 19:19643553-19643575 CAGGGACCGGGATGGGGATGGGG + Exonic
1163912936 19:20213855-20213877 GAGGGAGAGGGAGGGGGAGGCGG - Intergenic
1164056189 19:21623885-21623907 CAGGGAAAGGAAAGGGGACAAGG + Intergenic
1164202284 19:23028906-23028928 CAAGGAATGGAAAGGGGAGTGGG + Intergenic
1164234912 19:23323424-23323446 AAAGGAAAAGAATGGGGAGAAGG - Intronic
1164411469 19:28009372-28009394 CAAGGGAAGGAATGGGAAGCCGG + Intergenic
1164501371 19:28823167-28823189 CAGGGAGAAGAGTGGAGAGGGGG + Intergenic
1164516459 19:28940555-28940577 CAAGGGAAGGAATGGGAAGCAGG + Intergenic
1164619071 19:29682972-29682994 CAGGGAAAGGGATGGAGGTGAGG + Intergenic
1165306371 19:35005294-35005316 CAGGGAGGGGGATCGGGAGGCGG + Intronic
1165586692 19:36922833-36922855 GATGGAAAGGAAAGGTGAGGTGG + Exonic
1165825556 19:38703774-38703796 CAGGGAGAGGAACTGGGTGGCGG + Intronic
1165863299 19:38920352-38920374 CAGGGAGAGGAAATGAGAGGAGG + Intronic
1165988266 19:39789712-39789734 CAGGGGAAAGAATGGGATGGAGG + Intergenic
1166075851 19:40413402-40413424 GGGGAAAAGGAATGGGGAGGGGG + Intergenic
1166189997 19:41170168-41170190 CAGGGAGAGGGCAGGGGAGGGGG - Intergenic
1166348171 19:42179534-42179556 GAGGGAAAGGGAGGAGGAGGAGG + Intronic
1166368626 19:42289814-42289836 GAGGGAACAGTATGGGGAGGGGG - Intronic
1166380569 19:42353242-42353264 CAGGAACAGGAATGGGGCAGGGG - Intronic
1166387535 19:42390475-42390497 CAGGGAAAAGAAGGTGGCGGGGG + Intergenic
1166543743 19:43622411-43622433 TGGGGAGGGGAATGGGGAGGGGG - Exonic
1166643386 19:44513135-44513157 CAGGGAGGGGGATGGGGATGGGG - Intronic
1166796211 19:45427880-45427902 CAAGGAAATGAATCGGGAGCGGG - Intronic
1166845842 19:45727904-45727926 CGGGGACAGGAATGGGAATGGGG + Intronic
1166851421 19:45763315-45763337 CTGGGACAGGAAGGAGGAGGAGG - Intronic
1166851941 19:45765433-45765455 CAGGGACAGGAATGGGAGGGGGG - Exonic
1167166530 19:47803153-47803175 GAGGGAAAAGTAGGGGGAGGAGG + Intronic
1167235022 19:48309085-48309107 CAGGGATCGGGGTGGGGAGGGGG - Intronic
1167354037 19:48992675-48992697 CAGGGAAGGGGATGGGGGGATGG - Intronic
1167602901 19:50464950-50464972 CAGGGAGAGGCAGGGGCAGGTGG - Intronic
1167686511 19:50960048-50960070 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1167924330 19:52810889-52810911 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1168133712 19:54337197-54337219 CAGGGAGAGGACTGGTGGGGAGG - Intronic
1168153496 19:54461125-54461147 GAGGGATGGGATTGGGGAGGAGG + Exonic
1168213676 19:54909687-54909709 CAGAGAAAGGAATGGTAAGGCGG + Intronic
1168336349 19:55599624-55599646 CTGGGAAAGGAAAGGGAAAGAGG - Intronic
1168353871 19:55690579-55690601 CAGGGAGAGGCCAGGGGAGGAGG - Intronic
1168390090 19:56000010-56000032 CATTGAAAAGAGTGGGGAGGTGG - Intronic
1168402513 19:56093566-56093588 CAGGGAAAGGGATGGGAGGAGGG - Intronic
1168463860 19:56586199-56586221 CAGGGGAAGGAATGCTGCGGTGG + Intronic
1168464991 19:56595009-56595031 GAGGGAAAGGAGGGGCGAGGAGG - Intergenic
1168550911 19:57292723-57292745 CAGGGAAAATAAAGGGGATGAGG - Exonic
1168719335 19:58546206-58546228 CAGGGAAAGGCATGGTGTGAAGG + Intronic
1202703905 1_KI270713v1_random:6579-6601 CAGTGAGGGGAATGGGGAGAAGG - Intergenic
925127820 2:1473483-1473505 TAGGGAAAAGAATGGTGATGCGG - Intronic
925146634 2:1587076-1587098 AAGGAGAAGGAATGTGGAGGTGG + Intergenic
925157538 2:1658900-1658922 CAGGGCAAGGCATGGGCCGGAGG - Intronic
925186484 2:1850136-1850158 AAGGGGAAGGAAAGGGAAGGAGG - Intronic
925210762 2:2043660-2043682 CAGGGCAAGGAAGGGGGTGAAGG - Intronic
925292389 2:2756384-2756406 CAGGGAAGGGGTTGGGGAGACGG - Intergenic
925436455 2:3842426-3842448 CAGGGTGAGGAAGGGGGTGGTGG + Intronic
925548267 2:5041691-5041713 AAGGGAAAGGGAAGGGGAAGGGG - Intergenic
925548314 2:5041814-5041836 AAGGGAAAGGGAAGGGGAAGGGG - Intergenic
925573391 2:5334858-5334880 AAGGGAAGGGAAAGGGGAAGGGG + Intergenic
925602534 2:5623711-5623733 AGGGGAAAGGATGGGGGAGGAGG + Intergenic
925658849 2:6181332-6181354 GAGAAAAAGAAATGGGGAGGAGG - Intergenic
925905127 2:8535548-8535570 CAGGGAGAGGAAGGGGGCTGAGG + Intergenic
926266837 2:11330872-11330894 GAGGAAGAGGAATGAGGAGGAGG + Intronic
926714551 2:15913938-15913960 TATGGAAAGGAATGGACAGGAGG - Intergenic
926986131 2:18626079-18626101 GAGAGAAAGGAAGGAGGAGGAGG + Intergenic
927139630 2:20120775-20120797 TGGGGAAAGGAAAGGGGAAGAGG + Intergenic
927201984 2:20583618-20583640 GTGGCAAAGGAGTGGGGAGGAGG + Intronic
927664318 2:25019467-25019489 CAGAGAAGGGAATGGAGAGGAGG - Intergenic
927705898 2:25296434-25296456 CAGGGAAAGGAGTGGTCAGATGG + Intronic
928092879 2:28386803-28386825 CTGGGAAAGCAAGGGGGAAGGGG - Intergenic
928248442 2:29652828-29652850 TAGGGCAAGGTATGGGGAAGGGG - Intronic
928322045 2:30291642-30291664 AAGGGAAACTAGTGGGGAGGAGG + Intronic
928429297 2:31204699-31204721 CAGGGCAAGGCATGGGGAAGGGG - Intronic
928522806 2:32106769-32106791 CAGAGGAAGGAATGGGAAGAGGG - Intronic
928683566 2:33726911-33726933 GAAGGAAAGAAAAGGGGAGGAGG + Intergenic
928728817 2:34206836-34206858 CTGGGAAAGTAATGGGGGGAGGG - Intergenic
928979838 2:37126466-37126488 AAGGGAAAGGAGTGGGGAGGCGG - Intronic
928983136 2:37156672-37156694 CAGGGAAAGGATCGTGGAGCGGG - Intronic
929188543 2:39120261-39120283 CTGGGGAAGGGCTGGGGAGGCGG - Intronic
929302726 2:40324651-40324673 AAGGGAAAGGAAGGGAGAGAGGG - Intronic
929357933 2:41049472-41049494 AGAGGAAAGGAAAGGGGAGGGGG - Intergenic
929588254 2:43129604-43129626 CAGAGAAGGGAAAGGGGAGAGGG - Intergenic
929891710 2:45923839-45923861 CATGGAAAGCAAAGGTGAGGTGG + Intronic
930232203 2:48854747-48854769 CAGAAAAAGGAATGGGAAGGGGG - Intergenic
930363461 2:50411042-50411064 GAGGGAGAGGGACGGGGAGGGGG - Intronic
930637206 2:53819770-53819792 CGGGGAAAGAAAGGGGGAGGGGG - Intergenic
930730393 2:54723497-54723519 CAGGGACAGGCAGAGGGAGGGGG + Intronic
930828420 2:55717317-55717339 CAGAAACAGGAATGGAGAGGAGG + Intergenic
931093516 2:58913569-58913591 TAGTGAAAGAAATGGGGTGGAGG - Intergenic
931128082 2:59299640-59299662 GAAGGAAAGGGAAGGGGAGGCGG + Intergenic
931529969 2:63202836-63202858 CAAGGGAAGGAAGGAGGAGGAGG - Intronic
931613076 2:64125066-64125088 CAGGGCAAGGTATGTGGGGGTGG + Intronic
931909413 2:66880883-66880905 CAGGGAAAGGAATGTGGCATTGG - Intergenic
931967643 2:67551022-67551044 CAAGGAAAAGACCGGGGAGGTGG + Intergenic
931980066 2:67685235-67685257 CAGGGCAAGCCTTGGGGAGGAGG - Intergenic
932219225 2:69987153-69987175 GAGGGGAAGGCATTGGGAGGAGG + Intergenic
932231868 2:70089605-70089627 CAGGGAAAGGAAAGGAAGGGAGG + Intergenic
932330132 2:70894071-70894093 GAGGCAAAGGGAGGGGGAGGTGG + Intergenic
932552973 2:72790934-72790956 CTGGGAACAGAATGGGGAAGGGG + Intronic
932601518 2:73129900-73129922 CAGGGAAGAGAAAGAGGAGGTGG + Intronic
932667295 2:73708037-73708059 CAGGGACAGGGATGGGGTGGGGG + Intergenic
932747396 2:74345159-74345181 AAGTGAAAGGAATGTGGAAGGGG + Intronic
932825314 2:74933669-74933691 CAGGGAAAAGAATGGGAGAGTGG - Intergenic
933873044 2:86588595-86588617 AAGGGAAAGGAATTGCAAGGAGG + Intronic
933899326 2:86837781-86837803 CACTGAAAGGAAGGGGGCGGGGG + Intronic
934049197 2:88196185-88196207 CAGGGGCAGGAGCGGGGAGGAGG - Intergenic
934474067 2:94581105-94581127 CATGGAAAGGACACGGGAGGAGG - Intergenic
934653268 2:96104234-96104256 GAGGGAGAGGAAGGAGGAGGAGG - Intergenic
934960131 2:98665727-98665749 CAGAGTGATGAATGGGGAGGGGG + Intronic
935054338 2:99552635-99552657 CTGGGGCAGGGATGGGGAGGTGG + Intronic
935308414 2:101759670-101759692 GGGGGAGGGGAATGGGGAGGGGG - Intronic
935448308 2:103180170-103180192 CATGGATGGGAGTGGGGAGGGGG - Intergenic
935538884 2:104326264-104326286 TAGGGGAAGGTATGGAGAGGTGG + Intergenic
935655649 2:105420593-105420615 CAGAGAGAGGGATGGCGAGGAGG + Intronic
935680847 2:105635826-105635848 CAAGGGAAGGAATGAGCAGGTGG - Intergenic
935712830 2:105914237-105914259 CAGGGAAATGAGCAGGGAGGCGG - Intergenic
935725211 2:106018122-106018144 CAGGGCAAGGAGTGGGGAGTGGG + Intergenic
935757381 2:106287003-106287025 AAGGGAAAGGGAAGGGGAAGGGG - Intergenic
935781232 2:106511447-106511469 CACTGAAAGGAAGGGGGCGGGGG - Intergenic
936078179 2:109415029-109415051 CAGGGAAGGGGATGGCGTGGTGG + Intronic
936242805 2:110802478-110802500 AAGGGAAACCCATGGGGAGGTGG - Intronic
936284436 2:111171434-111171456 CAGGGAAAGAAAGGGGCAGTGGG - Intergenic
936816054 2:116462267-116462289 CTTGGAAAGGCAGGGGGAGGAGG + Intergenic
936939632 2:117871049-117871071 CGGGGAGAGGGAGGGGGAGGAGG - Intergenic
937075791 2:119105489-119105511 CAGGGAGAGAACTGGGAAGGAGG - Intergenic
937171379 2:119873504-119873526 CAGGGAAAAGAATGGGAAATTGG + Intronic
937463626 2:122110478-122110500 CAGGAAAAGGATAGGGGAGCTGG + Intergenic
938041920 2:128083102-128083124 CTGGGAAAGGAATGGTAATGAGG + Intergenic
938647023 2:133342229-133342251 CAGGGAAAGGAAATGGGGGAGGG + Intronic
939201902 2:139046111-139046133 CAAGGAAGGGAGTGTGGAGGAGG + Intergenic
939367362 2:141250495-141250517 TAGGGCAAGGAACGGGAAGGTGG - Intronic
939469367 2:142600149-142600171 AGGAGAAAGGAATGGGGAAGTGG - Intergenic
939512052 2:143119470-143119492 GAGGGGAAAGGATGGGGAGGGGG - Intronic
939766153 2:146252204-146252226 GAGGGGAAGGAAAGGGGAAGGGG + Intergenic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
940261173 2:151780983-151781005 GAGGGAGAGGTAGGGGGAGGGGG + Intergenic
940478905 2:154203127-154203149 CAGTGTGAGGCATGGGGAGGAGG + Intronic
940612493 2:156007558-156007580 GTGGGAAGGGAATGGAGAGGAGG - Intergenic
940669368 2:156648872-156648894 AAAGGAAGGGAAAGGGGAGGGGG - Intergenic
940769704 2:157826806-157826828 AAAGGAAAGGAAAGGGGAGAGGG + Intronic
940788051 2:158003078-158003100 CAGGGATAGCCATGAGGAGGTGG - Intronic
941029246 2:160493211-160493233 CAGGGTCAGGCCTGGGGAGGGGG - Intronic
941173778 2:162172055-162172077 CTGGGAAAGAAATGGGGGAGGGG - Intronic
941409854 2:165141014-165141036 AAAGGAAAGGAATGGGATGGGGG + Intronic
941649675 2:168079996-168080018 CAGAGAGAGGAATGGAGAGTTGG - Intronic
941658451 2:168169839-168169861 CAGGTAAAAGAAGGGGCAGGGGG + Intronic
941814994 2:169787355-169787377 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
942312714 2:174670291-174670313 CAGGGAGAGGAAAAGGGAGGAGG - Intronic
942533689 2:176940260-176940282 CAGAAAAAGGAATGGGGAACTGG - Intergenic
942567732 2:177283153-177283175 CAGGGTGAGGAAAGGGGAGTAGG + Intronic
943100151 2:183478495-183478517 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
943707108 2:191047197-191047219 CAGGGCAAGGCATGGAGAAGGGG - Intronic
943793681 2:191965232-191965254 CAGGGGAAGGAAGTGGGAGAAGG - Intronic
944127249 2:196308102-196308124 CACCGAAAGGAATTAGGAGGAGG + Intronic
944218464 2:197278755-197278777 GAGAGAAAGGAAAGGGGTGGTGG - Intronic
944309851 2:198221692-198221714 TTGGGAAAGGAATTGTGAGGGGG - Intronic
944389564 2:199203521-199203543 CAGGGAAAGCAGTTGGGAGTGGG - Intergenic
944403336 2:199353719-199353741 AAGGGAAAGGAAGGGAGAGAAGG - Intronic
944491187 2:200259226-200259248 CAGTAAAGGGAATGGTGAGGCGG + Intergenic
944653757 2:201857835-201857857 CAGGGATGGGGATGGGTAGGGGG - Intronic
944823127 2:203451741-203451763 CCAGGAAAGAAGTGGGGAGGAGG - Intronic
945212111 2:207394481-207394503 CAGGGAAAGGGGTTGCGAGGAGG + Intergenic
945530634 2:210950112-210950134 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
945536791 2:211027025-211027047 TAGAGATAGGAATGGGCAGGTGG - Intergenic
945688544 2:213004337-213004359 CAGGGAAAGGGATCAGTAGGCGG - Intronic
946074962 2:217066230-217066252 AAAGGAAAAGAATGGGGTGGAGG - Intergenic
946256908 2:218449058-218449080 CCAGGAAAGGGATGGAGAGGAGG - Intronic
946408741 2:219506218-219506240 CAGTGAAAGGTAAGGGGAAGAGG - Intronic
946538427 2:220657550-220657572 CAGTGAGATGAATGGGGAGCCGG + Intergenic
946610082 2:221448546-221448568 AAGGGAAAGGACGGGGGTGGAGG - Intronic
947448135 2:230180201-230180223 CAGGGAAAGGAAAAGCAAGGTGG + Intronic
947523109 2:230863697-230863719 GGGGGGAGGGAATGGGGAGGTGG - Intergenic
947671117 2:231936062-231936084 AAGGGAAAGGGAAGGGAAGGAGG - Intergenic
948274239 2:236695811-236695833 CATGGAAAGACCTGGGGAGGTGG + Intergenic
948307146 2:236956769-236956791 CTGTGAAAGGAAAAGGGAGGAGG - Intergenic
948327709 2:237139927-237139949 CACAGGAAGGAATGGGGAGGGGG - Intergenic
948448569 2:238053780-238053802 TAGAGACAGGAATGGGCAGGAGG + Intronic
948501474 2:238397814-238397836 GAGGGGTAGTAATGGGGAGGGGG + Intronic
948501488 2:238397858-238397880 GAGGGGTAGTAATGGGGAGGGGG + Intronic
948501530 2:238397990-238398012 GAGGGGAAGTAATGGGGAGGGGG + Intronic
948501544 2:238398034-238398056 GAGGGGAAGTAATGGGGAGGGGG + Intronic
948501558 2:238398078-238398100 GAGGGGAAGTAATGGGGAGGGGG + Intronic
948546332 2:238731750-238731772 CTGGGAACGGAATGGGCAGGTGG + Intergenic
948561314 2:238855274-238855296 AAGGGAAAGGAAGGAGGAGAAGG + Intronic
948781311 2:240323555-240323577 TCCGGAAAGGAATGAGGAGGTGG + Intergenic
948815868 2:240510139-240510161 GAGGGCACGGATTGGGGAGGAGG - Intronic
948974590 2:241456725-241456747 CCTGGAAATGAACGGGGAGGGGG - Exonic
1169082293 20:2804995-2805017 GAGGGAAGGGAAAGGAGAGGAGG - Intergenic
1169393356 20:5208176-5208198 AAGGAAAAGGAAGGGAGAGGAGG - Intergenic
1169449702 20:5701334-5701356 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1170490009 20:16863190-16863212 CAGGAAAAGGAATGTTAAGGTGG + Intergenic
1170762548 20:19263618-19263640 CAGGGAAAGGAGAGAGGATGTGG - Intronic
1170861238 20:20105461-20105483 GAAGGAAAGAAAAGGGGAGGAGG - Intronic
1171001620 20:21421842-21421864 AGGGGAAAGGAATGGGGAGGGGG - Intergenic
1171111193 20:22484006-22484028 GAGGGAAAGAAGTGGGGAAGAGG - Intergenic
1171173260 20:23034090-23034112 CTGGGACAGCGATGGGGAGGAGG - Intergenic
1171474516 20:25397825-25397847 AAGGGAAGGGAAAGGGGAAGGGG + Intergenic
1171848662 20:30292671-30292693 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1171914379 20:31052160-31052182 AATGGAATGGAATGGAGAGGAGG + Intergenic
1171915057 20:31056524-31056546 AATGGAATGGAATGGAGAGGAGG + Intergenic
1171917487 20:31071966-31071988 AATGGAATGGAATGGAGAGGAGG + Intergenic
1171973883 20:31581578-31581600 CAGGGAAGGGAGTGAGGGGGTGG + Intergenic
1172058871 20:32175344-32175366 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1172109090 20:32535022-32535044 CAGGGAAAGGAAGGAGGAGGTGG + Intronic
1172173942 20:32961110-32961132 CAGGGAACAGAGTGGGGAGCGGG - Intronic
1172329183 20:34062852-34062874 AAGGCATAGGAATGGGGCGGGGG + Intronic
1172355404 20:34276456-34276478 CAGGGAGAGAAATAGAGAGGTGG - Intergenic
1172382447 20:34506635-34506657 CATGGACAGGAGTGGAGAGGGGG - Intronic
1172512516 20:35510271-35510293 AAGGGAAAGGAATAGGAAGAGGG + Intronic
1172651513 20:36505881-36505903 GAGGAAGAGGAATGGGGAAGAGG + Intronic
1172965731 20:38833294-38833316 CAGGGACAGGAGTGGGTTGGAGG + Intronic
1173128657 20:40365560-40365582 ATGGGAAAGGAATGGGGATCTGG + Intergenic
1173294281 20:41742203-41742225 AAGGGGAAGGAAGGGGAAGGAGG - Intergenic
1173553672 20:43950483-43950505 CAGAGCAAGCAGTGGGGAGGGGG - Intronic
1173664445 20:44754605-44754627 CAAGGGAAGGAAGGGGGCGGAGG + Intronic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1173735694 20:45359857-45359879 AGGGGAAAGGAAAGGGCAGGAGG + Intergenic
1173890688 20:46507240-46507262 AAGGGAAAGGGAAGGGGAAGGGG + Intronic
1173980172 20:47217910-47217932 CAGGGAGTGGAAGGGAGAGGAGG - Intronic
1173981230 20:47225579-47225601 GAGGGGAAGGAAGGGGAAGGAGG + Intronic
1174004307 20:47398261-47398283 AAGGGAAAGGAAGAGGGAGAGGG + Intergenic
1174042326 20:47708816-47708838 CACTGAAAAGAATGGGCAGGAGG - Intronic
1174062706 20:47843934-47843956 AAGGGAAGGGAAGGGGGAAGTGG + Intergenic
1174421403 20:50401360-50401382 CAGGGACAGGGATGGGAAGGAGG - Intergenic
1174495555 20:50939163-50939185 CAGGGAGAGGAATGGGGTGAGGG - Intronic
1174704780 20:52644229-52644251 GATGGCAAGGAGTGGGGAGGGGG + Intergenic
1174735709 20:52963955-52963977 CAGGGAAAGGCTCTGGGAGGAGG - Intergenic
1174749992 20:53102423-53102445 AAGGGAAAGAAAAGGAGAGGAGG + Intronic
1175010112 20:55726308-55726330 GAGGGTGAGCAATGGGGAGGTGG + Intergenic
1175533503 20:59690755-59690777 CCAGGAAAGGAAAGGGGATGGGG - Intronic
1175552421 20:59826161-59826183 GAGGACAAGGTATGGGGAGGAGG + Intronic
1175873959 20:62220725-62220747 GAGGAGAAGGGATGGGGAGGAGG + Intergenic
1175876624 20:62233179-62233201 CAGGGAACGGGAGGGGCAGGTGG - Intronic
1176118587 20:63444090-63444112 GAGGGAAGAAAATGGGGAGGGGG + Intronic
1176443172 21:6796023-6796045 GAGGGAGAGGAATGGGAAGTTGG - Intergenic
1176735683 21:10544046-10544068 CAGTGAAAGGAAGGAGGTGGTGG + Intronic
1176821339 21:13661066-13661088 GAGGGAGAGGAATGGGAAGTTGG - Intergenic
1176999727 21:15597334-15597356 CAGGGGAAAGGATGGGAAGGGGG - Intergenic
1177671774 21:24240939-24240961 CATGGAAGGCAATGGGAAGGTGG - Intergenic
1177747324 21:25234111-25234133 CAGGGACATGAATGGAGTGGAGG + Intergenic
1177803604 21:25852352-25852374 CCGGGAAAGGTAGGGGGAAGGGG + Intergenic
1178211791 21:30542976-30542998 CAGAGAATGGAAAGGGGAGTAGG - Intronic
1178322334 21:31614848-31614870 AGGGGAAAGGGAAGGGGAGGTGG + Intergenic
1178350122 21:31866909-31866931 CAGGGAAGGGGATAAGGAGGTGG + Intergenic
1178526043 21:33330291-33330313 CAGGGGAGTGAGTGGGGAGGGGG - Intronic
1178702500 21:34845384-34845406 TCGGGAAAGGATTGAGGAGGGGG - Intronic
1178824666 21:36005030-36005052 GAGGGAGAGGCAGGGGGAGGGGG + Intergenic
1178856466 21:36254378-36254400 CTGGGAAAGGATGAGGGAGGAGG + Intronic
1178974716 21:37210892-37210914 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1179034922 21:37751410-37751432 CAGGGAGAGCAAACGGGAGGTGG + Intronic
1179163873 21:38919946-38919968 TAGGGAAAGGAAAGGAGAGAGGG - Intergenic
1179417660 21:41211164-41211186 GGGGGAGAGGGATGGGGAGGGGG - Intronic
1180109580 21:45641911-45641933 CGGGGAAGGGAATGTGGAGTGGG - Intergenic
1180211382 21:46297255-46297277 GTGGGAAGGGAAGGGGGAGGAGG - Intronic
1180963703 22:19774815-19774837 GGGGGAGAGGAATGGGGAGTTGG + Intronic
1181093688 22:20491893-20491915 GGGGGAAAGGAATGGGTGGGTGG - Intronic
1181418561 22:22779700-22779722 GAGGGAAGGGAAAGGGGAAGGGG + Intronic
1181431228 22:22882964-22882986 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1181585927 22:23853802-23853824 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1181659734 22:24335522-24335544 CTGGGAAAGGAAAAGGGATGTGG + Intronic
1181720975 22:24774232-24774254 CAGGAAAAGAAAGGGGGTGGAGG - Intronic
1181858805 22:25802253-25802275 CAGGGCAAGGGATGGGGAGAGGG + Intronic
1181881900 22:25987946-25987968 CATGGAGAGAAATTGGGAGGTGG - Intronic
1181961155 22:26622637-26622659 TAGGAAGAGGCATGGGGAGGGGG + Intronic
1181965457 22:26653411-26653433 CAAGGCAAGCAGTGGGGAGGTGG - Intergenic
1181998793 22:26903612-26903634 GAGGGAAAGGGCTGGGGAGGGGG + Intergenic
1182466810 22:30522025-30522047 AAAGGAAAGGAAAGGGGAAGGGG - Intergenic
1182478545 22:30591018-30591040 CTGGGAAGGGAATGGGAATGAGG - Intronic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1182609207 22:31532529-31532551 AAGGGAAAGAAAAGGGGAAGAGG - Intronic
1182886393 22:33777632-33777654 GAGGGAGGGGAAGGGGGAGGGGG + Intronic
1183024253 22:35052302-35052324 GAGGGAAAGGGATGGGGGGTGGG - Intergenic
1183078957 22:35444198-35444220 AAGAGAGAGGAAAGGGGAGGAGG + Intergenic
1183363980 22:37397543-37397565 CAGGGAAAGGAGGGGGAACGTGG + Intronic
1183533525 22:38379694-38379716 CAGTGAAAGGAAGGAGGTGGTGG - Intronic
1183595035 22:38806307-38806329 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1183617694 22:38955267-38955289 CAGGGACAGAAATGGGGGAGGGG + Intronic
1183621891 22:38978635-38978657 CAGAGGAGAGAATGGGGAGGAGG + Intronic
1183848400 22:40562580-40562602 AAGGGAAGGGAAAGGGAAGGAGG + Intronic
1183949946 22:41347313-41347335 CGAGGAAAGGCATGTGGAGGAGG - Intronic
1184198735 22:42950413-42950435 GAGGGAAGGGAGTGGGCAGGTGG + Intronic
1184425521 22:44406971-44406993 CAGGAAGAGGAATGGAGATGAGG - Intergenic
1184427522 22:44421714-44421736 GAGGGGAAGGGATGGGAAGGGGG - Intergenic
1184453667 22:44597350-44597372 CATGGACAGGAATGGGGAGCTGG - Intergenic
1184606879 22:45579419-45579441 CTGGGAACGGAATGTGGATGAGG + Intronic
1184635425 22:45824858-45824880 CAGGGAAATTCATGGGTAGGAGG + Intronic
1184697462 22:46148010-46148032 CAGGGAAAGAATTGGGAAGCTGG - Intergenic
1185323308 22:50212600-50212622 CAGGGAGGGGAATGGGGAGCTGG - Intronic
1203302848 22_KI270736v1_random:89103-89125 AAGGGAATGGAATGAAGAGGAGG + Intergenic
1203312364 22_KI270736v1_random:151706-151728 AATGGAATGGAATGGAGAGGAGG + Intergenic
949094760 3:73190-73212 GAGTGAAAACAATGGGGAGGGGG - Intergenic
949244100 3:1905179-1905201 CAGTGACAAAAATGGGGAGGTGG + Intergenic
949353117 3:3146245-3146267 CTGGGAAAAGAAAGAGGAGGTGG + Intronic
949499804 3:4668931-4668953 AGGGGAAAGAAATGGGGAGAGGG - Intronic
949773861 3:7609558-7609580 CAGGCACAGGTATGGGTAGGTGG + Intronic
950037190 3:9895080-9895102 CAGGAAGAGGAATGGGTATGAGG - Intergenic
950116383 3:10452771-10452793 CAGGGAAAAGAATTGAGATGAGG + Intronic
950138986 3:10602123-10602145 CAGGGCAGGAAGTGGGGAGGGGG - Intronic
950204436 3:11067907-11067929 AAGGGGATGGAATGGGAAGGTGG - Intergenic
950660346 3:14463419-14463441 CAGGGACAGGGGTGTGGAGGTGG - Intronic
950804860 3:15591432-15591454 CCGGGGAGGGAATGAGGAGGAGG - Intronic
950844834 3:16005040-16005062 CAGAGATAGGATGGGGGAGGCGG - Intergenic
950999631 3:17543107-17543129 AAGGGAAAGGAATGGAAGGGAGG + Intronic
951051546 3:18099360-18099382 CAGGAACAGGAATGAGAAGGGGG - Intronic
951686839 3:25354009-25354031 GGTGGAAAGGAATGGGGAGAGGG - Intronic
952089247 3:29864844-29864866 AAGGGAAAGGGAAGGGGAAGGGG + Intronic
952331241 3:32366241-32366263 CTTGGAAAGAAATGGGGAAGGGG - Intronic
952503908 3:33989894-33989916 GAGGGAAAAGAGTGGGGACGGGG - Intergenic
952855487 3:37767087-37767109 CACGCAAAGGAAGAGGGAGGAGG + Intronic
952906750 3:38144132-38144154 CAGGGAGAGAATTGGGGAGAGGG + Intergenic
952972055 3:38657579-38657601 CAGGGACAGGAATGGGGCTGAGG + Intergenic
953285462 3:41602343-41602365 AAGGGAAAGGAAAGGAAAGGAGG + Intronic
953865594 3:46580520-46580542 CATGGTAAGGTATGGGGAGGGGG - Intronic
954263367 3:49455836-49455858 CAGGGTAAGGAATTGGGAGGAGG - Intergenic
954290770 3:49648870-49648892 CAGGCAGAGGAATGGGGCAGTGG - Intronic
954297918 3:49684457-49684479 CAGTGAGGGGAATGGGGAGAGGG + Intronic
954432955 3:50480926-50480948 AAGGGGGAGGAAGGGGGAGGAGG + Intronic
954876510 3:53806144-53806166 GAGGGAAAAGAAGGAGGAGGAGG - Intronic
954876534 3:53806212-53806234 AAGGGAGAGGAAGGGGGAGGAGG - Intronic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
955802129 3:62697258-62697280 CAGGGGAAAGGATGGGGAGGGGG - Intronic
956061201 3:65349791-65349813 CAGGGAGAGGAATCTGTAGGTGG + Intergenic
956216910 3:66858520-66858542 AAGGGAATGGGATGGGAAGGTGG - Intergenic
956748635 3:72329291-72329313 CTGGGAAAGGGATGGGGACACGG + Intergenic
957204238 3:77174200-77174222 CAAGCAAAGCTATGGGGAGGGGG - Intronic
957311556 3:78526151-78526173 CTGGGGAAGGAGAGGGGAGGAGG - Intergenic
957672943 3:83328651-83328673 AAGGGAAAGGGAAGGGGAAGGGG + Intergenic
958537960 3:95428641-95428663 AAGGGAAAAGAATGGGGACAGGG - Intergenic
958906581 3:99948531-99948553 GAGGGGAAGGGAGGGGGAGGGGG + Intronic
959107292 3:102079128-102079150 CAGGGAAATGAGTGGAGAGGAGG - Intergenic
959164383 3:102758720-102758742 CAGTGAGATGAATGGGGAGCTGG + Intergenic
959246958 3:103882674-103882696 TAGGAAAAGGAAAGGAGAGGAGG + Intergenic
959358863 3:105366330-105366352 AAAGGAAAGGAAAGGGCAGGAGG - Intergenic
959548807 3:107630388-107630410 CGTGCAAAGGAGTGGGGAGGAGG - Intronic
960344726 3:116518631-116518653 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
960357189 3:116668035-116668057 CAGGGTAAGGAATAAGGAAGAGG - Intronic
960663212 3:120083403-120083425 CAGGAAAAGAAAGGGGCAGGAGG + Intronic
960697894 3:120413791-120413813 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
960785804 3:121372010-121372032 CTGGCAAAGCAATGTGGAGGTGG + Intronic
960987245 3:123288946-123288968 TGGGGAAAGAAATGGTGAGGAGG - Intronic
961748183 3:129079313-129079335 AAGGGAAAGGAAGGGAGGGGAGG + Intergenic
962072336 3:132044935-132044957 GAGGGAAGGGGAGGGGGAGGGGG + Intronic
962249663 3:133828077-133828099 CAGGGAAAGAGAAGGAGAGGTGG + Exonic
962396996 3:135024741-135024763 TAGGGAAAAGAATGGGGTAGGGG - Intronic
962479432 3:135785782-135785804 CAGGGGACAGAGTGGGGAGGTGG + Intergenic
963492958 3:146023842-146023864 CAGGAAAGGGAAAGGGAAGGAGG - Intergenic
963500650 3:146121217-146121239 CAAGGAGAAGAATGGAGAGGTGG - Exonic
963850674 3:150207497-150207519 GCGGGAAGGGAATGGGGAAGAGG - Intergenic
964251996 3:154728524-154728546 GTGAGAAAGGAAGGGGGAGGGGG + Intergenic
964373971 3:156031401-156031423 CAGTGGAAGGAGTGGGGTGGAGG + Intergenic
964623024 3:158734122-158734144 CAGAAAAAGAAATGGGGAGTTGG + Intronic
964833303 3:160910183-160910205 CAGGGAAGGGGAAGGGGAAGGGG - Intronic
964833316 3:160910213-160910235 AGGGGAAAGGAAAGGGGAAGGGG - Intronic
964833323 3:160910231-160910253 AGGGGAAAGGAAAGGGGAAGGGG - Intronic
964839779 3:160981059-160981081 CAGGGCAAGGAAGGAAGAGGAGG - Intronic
964870168 3:161305287-161305309 CAGTGACAGGCATGGGGAGTGGG + Intergenic
965003377 3:162986644-162986666 CCAGGAATGTAATGGGGAGGTGG - Intergenic
965065171 3:163839243-163839265 CGGGGGATGGAATGGGAAGGTGG + Intergenic
965170552 3:165258215-165258237 TAGGGCAAGGTATGGGGATGGGG + Intergenic
965721689 3:171668947-171668969 CAGGAAAAGGCATGGGTAGCAGG - Intronic
965737400 3:171836030-171836052 CAGATAAAGGGATGGAGAGGGGG + Intergenic
965772189 3:172193120-172193142 CAGGGAAAGGAAGGGAGGGAGGG - Intronic
966925109 3:184639617-184639639 CTGGGAAAGGCAGGGTGAGGGGG + Intronic
966961383 3:184943035-184943057 AAGGGAACGGAATGGGGTGGAGG - Intronic
967132275 3:186482775-186482797 CTGGGAAGGGGAGGGGGAGGAGG + Intergenic
967277968 3:187795259-187795281 CATGGGAAGGAAGAGGGAGGAGG + Intergenic
967318700 3:188174672-188174694 GAGGGAAAGCAATGGAGATGAGG - Intronic
967578684 3:191125779-191125801 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
967676223 3:192301845-192301867 CAGGGAAAGAAACAAGGAGGAGG + Intronic
968287047 3:197514854-197514876 CAGGGAAATCACAGGGGAGGTGG + Intronic
968339313 3:197941471-197941493 GAGGGAGGGGAAGGGGGAGGGGG - Intronic
968630637 4:1649169-1649191 AAGGGAAAGGGAAGGGGAAGGGG + Intronic
968630650 4:1649199-1649221 AAGGGAAAGGGAAGGGGAAGGGG + Intronic
968645765 4:1739864-1739886 CGGGGACAGGGATGGCGAGGGGG - Intronic
968647801 4:1749003-1749025 GAGGGAGAGCAGTGGGGAGGGGG - Intergenic
968653008 4:1767425-1767447 GAGGGAGAGGGAGGGGGAGGAGG - Intergenic
968655832 4:1778090-1778112 AAGGAAAAGGAATGCAGAGGTGG + Intergenic
968799257 4:2731568-2731590 AGGGGAAAGGACTCGGGAGGAGG - Intronic
968855920 4:3121940-3121962 CAGAGAAAAGAATCAGGAGGAGG - Intronic
969152885 4:5185533-5185555 CAGGGAAAGGGACGTGGGGGAGG + Intronic
969307735 4:6335456-6335478 CAGAGAAAGGAGTGAGCAGGGGG + Intronic
969331418 4:6475242-6475264 GATAGAAAGGAACGGGGAGGAGG + Intronic
969353352 4:6610966-6610988 CAGCCAAGGGAATGGGCAGGTGG + Exonic
969454843 4:7295027-7295049 GAGGGAGAGGAGGGGGGAGGAGG - Intronic
969508518 4:7603170-7603192 CATGGAAAGAGAGGGGGAGGGGG + Intronic
969599457 4:8167336-8167358 CAGGAGAAGGAATGGGGGTGGGG - Intergenic
970049757 4:11900398-11900420 CAGGGAAAAAAATGGGAAGAAGG - Intergenic
970194756 4:13542988-13543010 CAGGTAAGGGAAGGTGGAGGCGG + Intronic
970306528 4:14738217-14738239 GAGGCAAAGAAATGGGGAGGTGG - Intergenic
970409057 4:15790169-15790191 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
970495076 4:16616995-16617017 GGGGGAGAGGAAAGGGGAGGAGG - Intronic
970903050 4:21182417-21182439 AAGGGAAAGGAAAGGACAGGGGG - Intronic
971164832 4:24172294-24172316 CAGGGGATGGAGTGGGGTGGAGG - Intergenic
971217510 4:24674670-24674692 CAGGGATATGGATGGGGAGAAGG - Intergenic
971251297 4:24975422-24975444 AAGGAGAAGGAAGGGGGAGGAGG + Intronic
971346317 4:25815073-25815095 CAGGGAAAGGCAGGGAGAAGAGG + Intronic
971369859 4:26009690-26009712 CAGGGAAGGAACTGGGTAGGTGG - Intergenic
971392983 4:26203376-26203398 CAGGGAAGGGCCTGGGGAGAAGG - Intronic
971633852 4:29031457-29031479 CAGGGAAAAGGAGGAGGAGGAGG - Intergenic
971811374 4:31432414-31432436 CAGGGAAGGGAATAGGGAACAGG + Intergenic
971831510 4:31701623-31701645 CTGGGAAGGGAGTGGGAAGGTGG - Intergenic
972080948 4:35148104-35148126 TAGGGAGAGGAATATGGAGGGGG + Intergenic
972169178 4:36324135-36324157 AAGAGAAAGGAATGGGGGGGAGG - Intronic
972231906 4:37082482-37082504 GAGTGAAAGGCAAGGGGAGGGGG + Intergenic
972270890 4:37509981-37510003 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
972564604 4:40258707-40258729 GAAGGAAAGGAGTGGGGAAGGGG + Intergenic
972653967 4:41048643-41048665 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
972802929 4:42496245-42496267 CAGGGAAAGGAAGGAAGAGTGGG + Intronic
973193123 4:47409366-47409388 CAGTGAGATGAATGGGGAGCTGG + Intronic
973752166 4:54032271-54032293 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
973978683 4:56287781-56287803 AAAGGAAAGGAAAGAGGAGGTGG + Intronic
974013644 4:56629608-56629630 CAGGGGAATGACTGGGTAGGAGG - Intergenic
974082927 4:57231283-57231305 TAGAGTAAGGAATGGGGAAGGGG - Intergenic
974093681 4:57339040-57339062 AAGGGAAAGGAAGGGAAAGGAGG - Intergenic
974846648 4:67359111-67359133 CAGGGCAAGGAATGGGGGAAAGG - Intergenic
975060100 4:69986208-69986230 CTGGAAAAGGGATGGGGAGTGGG + Intergenic
975095030 4:70447930-70447952 CTGGGAAGGTAATGGGGAGTTGG - Intronic
975267663 4:72390008-72390030 CAGGAAAAGGAGAGGGGAAGCGG + Intronic
975633282 4:76422716-76422738 GAGGGAAAAGGAGGGGGAGGGGG - Intergenic
975687231 4:76929173-76929195 AGGGGAAAGGAAGGGAGAGGAGG + Intergenic
976022808 4:80650856-80650878 CAGGGGAAAGGATGGGAAGGGGG + Intronic
976073141 4:81264973-81264995 CAAGAAAAGGTAGGGGGAGGGGG - Intergenic
976217887 4:82731812-82731834 GACGGAAGGGAATGGGGAGCAGG - Intronic
976225054 4:82789323-82789345 GAGGGGAAGCAAAGGGGAGGAGG + Intronic
976259043 4:83128457-83128479 CAGGGAAGGGGAAGGGGAAGGGG - Intronic
976315517 4:83655180-83655202 CTGGGAAAGGATTGGGCAGAAGG - Intergenic
976753773 4:88477316-88477338 AAGGGGAAGGGAGGGGGAGGGGG + Intronic
976753842 4:88477509-88477531 AACGGAAAGGAAGGGGGAGGGGG + Intronic
976828269 4:89284197-89284219 CAGGTGAAGGAATGGGTGGGTGG + Intronic
976828333 4:89284745-89284767 AAAGGCAAGGAATGGGGAGTTGG - Intronic
976836559 4:89381137-89381159 AAAGGAAAGGAAGGGGAAGGAGG - Intergenic
977146589 4:93448929-93448951 AAGGGAAAGGGAAGGGGAAGGGG - Intronic
977566872 4:98589457-98589479 CAGACAAAGGAAAGGGAAGGAGG + Intronic
977804600 4:101282022-101282044 CAGGAAAAGGTATGGGGTGGAGG - Intronic
977827811 4:101554286-101554308 CAGACAAAGGGGTGGGGAGGGGG - Intronic
977891707 4:102319619-102319641 CAGGGGTAGGAGTGGGGAGGGGG - Intronic
978397453 4:108296564-108296586 TAGGGACAGGAATGGGAGGGTGG + Intergenic
979521606 4:121674162-121674184 GAAGGAAAGGAAAGGGGAAGAGG + Intronic
979567998 4:122178656-122178678 CAGGATAAGGAATGTTGAGGAGG - Intronic
979980175 4:127245327-127245349 CTGGGAAAGGAAGAGGGAAGGGG + Intergenic
980065580 4:128184740-128184762 CAGGGACTAGAATGGGTAGGGGG - Intronic
980526331 4:133994717-133994739 CAGGGAAAGGAAACGGGAAAGGG - Intergenic
981001505 4:139833249-139833271 CAGAGAAAGACAGGGGGAGGGGG + Intronic
981069679 4:140521861-140521883 CGGGGACAGGAAGGGGGAAGGGG + Intergenic
981187778 4:141824443-141824465 AAGGGAAAGGATTGAGGAAGTGG + Intergenic
981511417 4:145562697-145562719 CACAGCAAGGAATGGGGAGGAGG + Intergenic
981563062 4:146067794-146067816 AAGGGAAAGGAAAGGAAAGGAGG - Intergenic
981672329 4:147301288-147301310 CATGGAAAGGCATGGGGATGAGG - Intergenic
981771032 4:148308574-148308596 CTGGGAAGGGTATGGGGAAGGGG + Intronic
981789703 4:148522164-148522186 CAGGGAAAGGTAAGGAGTGGGGG - Intergenic
982215102 4:153075972-153075994 CAGGGAAGGCAAGGGGGTGGGGG - Intergenic
982297017 4:153839550-153839572 CAAGGAAAGGAAATGTGAGGAGG - Intergenic
982753163 4:159187297-159187319 CAGAGAAAAAAAAGGGGAGGAGG - Intronic
982778543 4:159466411-159466433 CAAGGAAAGGAAAGGGAAAGGGG - Intergenic
982798408 4:159672811-159672833 TAGGGCAAGGTATGGGGAGGTGG - Intergenic
983072980 4:163291790-163291812 AAGGGAAGGGAAGGGGAAGGGGG + Intergenic
983906205 4:173184616-173184638 CAGGGAGAGGGAGAGGGAGGGGG + Intronic
983906209 4:173184622-173184644 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
984091283 4:175378504-175378526 CAGGGATGGGAAAGGGGAGTTGG - Intergenic
984098827 4:175463459-175463481 CAGGGAATGGAAAGAGGAGTGGG + Intergenic
984273899 4:177584110-177584132 CAGGGAAAGCAAAGGCGAGAAGG - Intergenic
984414299 4:179436678-179436700 CAGAGAAAGGAAGGGAAAGGTGG + Intergenic
984859023 4:184220119-184220141 AAGGGAAAGGAAAGGGAAAGGGG + Intronic
984954979 4:185036248-185036270 TTGGGAAACGAATGGGGAAGAGG - Intergenic
985038944 4:185869110-185869132 CAGGCACTGGAATGGGCAGGTGG + Intronic
985108529 4:186522916-186522938 CAGGAAAAAGACTGGGTAGGTGG + Intronic
985126688 4:186701675-186701697 CAGGAGAAGGAATGTGGAGGAGG - Intronic
985674076 5:1221340-1221362 TGGGGAGAGGAATGGGGAAGGGG + Intronic
985864039 5:2497849-2497871 GAGGGAAACAAGTGGGGAGGGGG + Intergenic
986062058 5:4201174-4201196 CAGGGAAAGGTATGAGGAAGAGG - Intergenic
986165279 5:5267457-5267479 AAGGGGATGGAATGGGTAGGTGG + Intronic
986230960 5:5864550-5864572 CAGGGAGATGGATGGGGAGCTGG + Intergenic
986572874 5:9183134-9183156 GAGGGAAAGGAATAGGGAGCAGG + Intronic
986773981 5:10996927-10996949 GAGGGAAAAGAAATGGGAGGTGG + Intronic
986828727 5:11551280-11551302 CAGGGAAAGAAATGGGGTAAAGG - Intronic
986875094 5:12097731-12097753 CATGGAAAGGAAAGGGGACTTGG - Intergenic
986946636 5:13029213-13029235 AAGGGAAAGGGAAGGGGAAGGGG + Intergenic
987225811 5:15840353-15840375 CTTGGAAAAGAATGAGGAGGAGG - Intronic
987683906 5:21171821-21171843 CAGGGAAAGGGAGGGGGGCGAGG + Intergenic
987766706 5:22240955-22240977 AAGGGCAAGGAAGGAGGAGGAGG + Intronic
987910169 5:24132488-24132510 GTGGGAGAGGGATGGGGAGGGGG + Intronic
988181741 5:27803942-27803964 TGGGGAAAGGAATGAGGAGTAGG - Intergenic
988424970 5:31053529-31053551 CAGTGAAAGGAATGAGGAAAGGG - Intergenic
988608781 5:32705548-32705570 GAGGAAGAGGGATGGGGAGGGGG + Intronic
988806835 5:34748039-34748061 AAAGGAAAGCAATGAGGAGGAGG + Intronic
989110378 5:37901745-37901767 CTGGCAAAGGAGTGGGGAGGAGG + Intergenic
989189238 5:38654140-38654162 CAAAGAAAGGAAAGGGGATGAGG - Intergenic
989608852 5:43272522-43272544 CAGGGGAAGGAAGGAGAAGGAGG + Intronic
989741554 5:44779263-44779285 AAGGGAAAGGGAAGGGGAAGGGG + Intergenic
990421709 5:55642030-55642052 CAAGGAAGGGAAAGGGGAAGGGG - Intronic
990446239 5:55896695-55896717 GAGGGGAGGGACTGGGGAGGGGG - Intronic
990501265 5:56398651-56398673 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
990756688 5:59079816-59079838 CAAGGAAAGGAAAGGAAAGGAGG + Intronic
991293898 5:65060961-65060983 CAGGGAGAGGAATGAGGCAGGGG + Intergenic
991493761 5:67208409-67208431 CAGGGAAGAGAAGTGGGAGGAGG + Intergenic
992579076 5:78152040-78152062 AAGGGAAGGGAAGGGGAAGGGGG - Intronic
992869298 5:80990425-80990447 CAGTGAAAGGAGTCGGGAGGGGG + Intronic
993094527 5:83465951-83465973 CAGGGAAGGGAAGGAGGATGGGG - Intergenic
993298877 5:86181943-86181965 AAGGGAAAGGATTGGAGGGGGGG + Intergenic
993948087 5:94138680-94138702 CAGGGAAAAGAGTGGGCAGGGGG - Intergenic
994048448 5:95335259-95335281 AAGGGAAAGGAAGGGAGGGGAGG - Intergenic
994135989 5:96287240-96287262 CAGTGGAAGGAAAGGGGAGGGGG - Intergenic
994198868 5:96949952-96949974 CAGAAAAAGGAAAGGTGAGGGGG - Intronic
994408295 5:99373935-99373957 CGGGGAAGGAAATGGGGAGATGG + Intergenic
994685606 5:102947522-102947544 CAGGGTAAAGGATGGGAAGGAGG + Intronic
995024181 5:107399425-107399447 GAGAGAAAGGAATGGGAACGTGG + Intronic
995180850 5:109228907-109228929 CGGGGAGAGGAAAGGGGAGAGGG + Intergenic
996087355 5:119318683-119318705 GAGGGACAGGAGAGGGGAGGGGG - Intronic
996133766 5:119813830-119813852 CAGGGAAGGGAATGGTAAGATGG - Intergenic
996387591 5:122925245-122925267 GAGGGGAAGGAAGGAGGAGGAGG - Intronic
996408442 5:123129971-123129993 AAGGGAAAGTAAAGGGGAAGGGG - Intronic
996681918 5:126237018-126237040 GGGGGAAAGGAAAGGGGAGATGG - Intergenic
996987936 5:129591103-129591125 CAGGGAAAGGCAATGGGAGTTGG - Intronic
997152378 5:131512060-131512082 TAGGAAAGGGAATGGGGAGGAGG + Intronic
997159977 5:131597691-131597713 CAGAGACTGGAGTGGGGAGGTGG + Intronic
997180108 5:131819452-131819474 CAGGGGGAGGGAGGGGGAGGGGG + Intronic
997773514 5:136576470-136576492 CAGGGAAAGAAATGCTGAGATGG + Intergenic
998017467 5:138743839-138743861 AAGGGAATGAAATGGGGAGGAGG + Intronic
998103649 5:139454929-139454951 CAGAGAAAAGAATGGGGTGAAGG + Intronic
998105027 5:139462938-139462960 AAGGGAAGAGAATGGGGATGGGG - Intergenic
998231431 5:140363659-140363681 CAGGGAAAGTAGCGGGGATGCGG + Intronic
998465665 5:142341864-142341886 GAGGGAAAAGAAGGGGGAGAAGG + Intergenic
998469835 5:142375134-142375156 CAGGAAAAGGAATTTGGAGCTGG - Intergenic
998537828 5:142951058-142951080 CTCGGAAAGGGAAGGGGAGGGGG - Intronic
998773591 5:145573487-145573509 CGGGCAGAGGAAAGGGGAGGGGG - Intronic
998816294 5:146017534-146017556 GTGGGACAGGGATGGGGAGGAGG - Intronic
999325529 5:150641197-150641219 CAGTGGGAGGAATGGGGAAGGGG + Intronic
999408091 5:151324952-151324974 CAGAGAGAGGAGTCGGGAGGTGG - Intronic
999698595 5:154207669-154207691 CAGGGAAATGGCTGGGCAGGGGG + Intronic
1000124068 5:158226473-158226495 GAGGGCAAAGAATGGGGATGGGG + Intergenic
1000156709 5:158559388-158559410 CAGAGAAAGAGATGGGGAAGGGG - Intergenic
1000263356 5:159611392-159611414 CAGGGAAGGGAAAGGGGAAAGGG - Intergenic
1000279353 5:159768763-159768785 CAGGGCAAGTTATGGGGATGAGG - Intergenic
1000308213 5:160015609-160015631 CAGGGAAAGGTAGAGGGAGAAGG - Intronic
1000370800 5:160534594-160534616 CAGTCAAAGGAATGGGGAAATGG + Intergenic
1000457404 5:161468315-161468337 CAGGGAAAGGAAGAGGGAATAGG - Intronic
1000480420 5:161766894-161766916 CAAGGTTGGGAATGGGGAGGAGG + Intergenic
1001000464 5:168001234-168001256 TAGGCAAAGGAATGGTTAGGGGG + Intronic
1001482487 5:172097989-172098011 CTGGGAAAGGAATGATGGGGTGG + Intronic
1001598139 5:172911451-172911473 CATGGCAGGGAATGGGGTGGAGG - Intronic
1001824593 5:174734902-174734924 CAGGGACAGGGATGGGGTGGGGG + Intergenic
1001835611 5:174828981-174829003 CATTGCCAGGAATGGGGAGGAGG - Intergenic
1002020616 5:176361884-176361906 CGGCGAAGGGCATGGGGAGGGGG - Exonic
1002067592 5:176659889-176659911 CATGTAAATGAATGGGCAGGTGG - Intergenic
1002330845 5:178439467-178439489 GAGGGAAAGGAAGAGGCAGGAGG - Intronic
1002864346 6:1107900-1107922 CAATGTGAGGAATGGGGAGGAGG - Intergenic
1002932971 6:1646997-1647019 CAGGGCAAGGAAGGGGCAAGAGG - Intronic
1002990144 6:2230944-2230966 TAGGGGAAGGAACGGGGGGGGGG - Intronic
1003142630 6:3484348-3484370 TAGGGAAAGGAATGGGAACAAGG + Intergenic
1003147394 6:3520312-3520334 CGAGGAAGGGAGTGGGGAGGAGG - Intergenic
1003611028 6:7615135-7615157 CAGGAAAAGCAATGAGGAGATGG - Intergenic
1003809850 6:9767644-9767666 CAGGGCATGCAATGGGGATGTGG + Intronic
1003981183 6:11391458-11391480 GAGGTCAGGGAATGGGGAGGTGG + Intergenic
1004278488 6:14258845-14258867 GAGGGATGGGACTGGGGAGGGGG + Intergenic
1004601731 6:17156890-17156912 GAAGGAAAGAAATGGGGAGGAGG - Intergenic
1004647208 6:17573926-17573948 AAGGGAATGGAGTGGGAAGGTGG + Intergenic
1004681833 6:17903632-17903654 CAGGCACAGGGATGGGGATGTGG + Intronic
1005089178 6:22038443-22038465 CAGTGAGAGGAAGGGGAAGGAGG - Intergenic
1005414673 6:25587037-25587059 AAGGGAGAGGGAGGGGGAGGGGG + Intronic
1005929649 6:30474458-30474480 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1005968020 6:30741438-30741460 CAGGGAAAGAAAGGAGGAGGAGG + Intronic
1006205841 6:32342001-32342023 CTGTGACAGGAATGAGGAGGAGG - Intronic
1006262312 6:32885367-32885389 CCTAGAATGGAATGGGGAGGAGG + Intergenic
1006270544 6:32962955-32962977 CTGGGAAAGGGAGGGGGTGGAGG + Intronic
1006301645 6:33196553-33196575 CAAGGATGGGGATGGGGAGGGGG - Exonic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1006433082 6:34010110-34010132 CGGGCAAAGGCAAGGGGAGGGGG - Intergenic
1006579539 6:35068853-35068875 CATGGAAAGGAGGGTGGAGGGGG + Intronic
1006594096 6:35179920-35179942 CATGGAGAGGCCTGGGGAGGGGG + Intergenic
1006689022 6:35863608-35863630 CAGGCAAATACATGGGGAGGGGG + Intronic
1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG + Intronic
1006941176 6:37753350-37753372 CAGGCAATTGACTGGGGAGGGGG - Intergenic
1006960047 6:37919976-37919998 CAGGGAAAGGAATGGTGTTTGGG - Intronic
1006970253 6:38036384-38036406 CAGGGATAGGATAGGAGAGGAGG + Intronic
1007249569 6:40486535-40486557 CTGGGTAAGGAATGGGTAGAGGG + Intronic
1007411456 6:41664487-41664509 CAGGGAAAGGAAGGAGAAAGTGG + Intergenic
1007591023 6:43021027-43021049 AAGGGAAGGGAATGGGGAGAAGG + Exonic
1007594255 6:43041716-43041738 AAGGGAAGGGAAGGGAGAGGTGG + Intronic
1007622062 6:43221350-43221372 GAGGGCAAGGAGGGGGGAGGAGG + Intronic
1007651332 6:43424613-43424635 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1007700981 6:43766461-43766483 AGGGGGAAGGAATGGGGAAGAGG - Intergenic
1007969932 6:46041451-46041473 TAAGGAAAGGAGTGGGGAGGTGG - Intronic
1008067253 6:47062541-47062563 CAAGGAAGGGAAAGGGGAAGAGG - Intergenic
1008160183 6:48067735-48067757 CAGTGAATGGAAGGGGGAGGGGG - Intronic
1008514636 6:52307456-52307478 CAGGGAGAGAAACGGGGAGGAGG - Intergenic
1008632090 6:53371804-53371826 CAGGGAAATGAATGAGGCGTGGG + Intergenic
1008748992 6:54709218-54709240 TAGGGAAGGGAAGGGGGAGGGGG + Intergenic
1008863238 6:56176912-56176934 AAGGGGGAGGAAGGGGGAGGAGG + Intronic
1009593667 6:65708587-65708609 AAGGGAAGGGAAGGAGGAGGAGG - Intergenic
1009593741 6:65708781-65708803 AAGGGAAGGGAATGGGGAAAAGG - Intergenic
1009869342 6:69434071-69434093 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1010071502 6:71750616-71750638 CAAGGAAAGGAAAGAGGAGTGGG + Intergenic
1010456653 6:76064020-76064042 GAGGCACAGGAATGGAGAGGGGG + Intronic
1010625836 6:78135367-78135389 CAGGGAAAGGAAAGGGAAAAGGG + Intergenic
1010849360 6:80752834-80752856 AAGGGATAGAATTGGGGAGGGGG - Intergenic
1011041587 6:83035253-83035275 CAGGGTAAGGAGTGGGCAGCAGG - Intronic
1011050942 6:83149140-83149162 TATGGAATGGAAAGGGGAGGGGG + Intronic
1011135714 6:84098109-84098131 CAGAGAAAGGGATGGGAGGGAGG - Intergenic
1011219018 6:85034655-85034677 CAGGGAAAGGATATGGTAGGTGG - Intergenic
1011819174 6:91230379-91230401 CAGAGAAAGGGAAGGGGAGAGGG - Intergenic
1012135096 6:95545743-95545765 CAAAGAAAGGCAAGGGGAGGGGG - Intergenic
1012140897 6:95625372-95625394 CTAGGAAAGGAATGTGGATGTGG - Intergenic
1012210402 6:96511132-96511154 AAGGAAAAGGAAAAGGGAGGTGG - Intergenic
1012270210 6:97199994-97200016 CAGGGAGAGAAATTGAGAGGAGG - Intronic
1012401558 6:98845836-98845858 AAGGGAAAGGAAAGGAGGGGTGG - Intergenic
1012422425 6:99079411-99079433 GAGGGAGAGGGATGGGGAGAGGG - Intergenic
1012588083 6:100947270-100947292 CATGGAAGGGAATGGGGAAAGGG + Intergenic
1012998363 6:105995111-105995133 AAGGCAAGGGAATGGGGAGGAGG - Intergenic
1013033156 6:106355958-106355980 GTGGGATAGGAATGGAGAGGAGG - Intergenic
1013068992 6:106711217-106711239 AGGGGAAAGGAAAGGGGAAGGGG - Intergenic
1013170658 6:107634455-107634477 GAGGGATAGGGATGGGGATGGGG - Exonic
1013206981 6:107954036-107954058 CAGGGAAAGGATTGGGAAATCGG + Intronic
1013491543 6:110651087-110651109 CAGGCAAAGGGTTGGGAAGGGGG + Intronic
1013711112 6:112900303-112900325 AAGGGAAGGGAAAGGGGAAGGGG - Intergenic
1013836794 6:114343153-114343175 CAGCGAAAGGGAGGAGGAGGAGG + Intergenic
1014867568 6:126550875-126550897 CAGGGGATGGAGTGGGAAGGTGG + Intergenic
1014925516 6:127266431-127266453 CAAGAAAAAAAATGGGGAGGGGG - Intergenic
1015079481 6:129206063-129206085 AAGGGAAAGGAAAGGAAAGGAGG + Intronic
1015106479 6:129542587-129542609 CAGGGAAAGGATTGGGGAGATGG - Intergenic
1015168328 6:130224054-130224076 AGGGGAATGGAATGGGAAGGCGG + Intronic
1015386715 6:132633049-132633071 CAAGGGAAAGAATGGGTAGGAGG + Intergenic
1015495297 6:133875447-133875469 GAGGGAAAGGGAAGGAGAGGAGG - Intergenic
1015552997 6:134431551-134431573 CAGGAAAGGGAATGGGGGGTGGG + Intergenic
1016167797 6:140969198-140969220 CAGAGAGAGAAAGGGGGAGGGGG + Intergenic
1016438262 6:144059472-144059494 CAGGAAAGGGAATTGAGAGGAGG - Intronic
1016458975 6:144262215-144262237 CTGGGATGGGAATGGGGTGGAGG + Intergenic
1016629614 6:146213158-146213180 GAGGGAATGGAAAGGGCAGGAGG + Intronic
1016785349 6:148005495-148005517 CAGGGAAAGGAAAGAGGAGGAGG + Intergenic
1016824320 6:148374281-148374303 CAGGAATATGAATGGGAAGGAGG + Intronic
1016882754 6:148927190-148927212 AAGGGGAGGGAAAGGGGAGGAGG + Intronic
1016951791 6:149587590-149587612 TAGGGCAAGACATGGGGAGGGGG + Intronic
1017293265 6:152765660-152765682 AAGGGAAAGGGAAGGGGAAGGGG - Intergenic
1017637419 6:156456306-156456328 GAGGGGAGGGGATGGGGAGGAGG - Intergenic
1017717978 6:157225271-157225293 CAGTGCAAGGATTGGGGATGTGG - Intergenic
1017931944 6:158963467-158963489 AAGGGAAGGGAAGGGAGAGGAGG - Intergenic
1017948493 6:159116162-159116184 CAGGGGATGGAGTGGGAAGGTGG - Intergenic
1018298629 6:162376761-162376783 GAGGGAAAGGGAGGGGGAGGGGG + Intronic
1018450601 6:163903680-163903702 CAGGGAAAGTAGTCGGGTGGGGG - Intergenic
1018525992 6:164710505-164710527 CAGGGAGATGGATGGGGAGCCGG + Intergenic
1018913846 6:168120843-168120865 CAGGGAGGGCAATGGGGTGGTGG + Intergenic
1018999050 6:168731647-168731669 CTGGGAAGGGTATGGGGAGGTGG + Intergenic
1019159120 6:170057708-170057730 GGGGGAAGGGAAAGGGGAGGGGG - Intergenic
1019274811 7:170701-170723 CAGCGAGAGGAAGGGGGTGGTGG - Intergenic
1019491247 7:1314597-1314619 CAGGGAGAGCAGTGGGGAAGAGG - Intergenic
1019517426 7:1446191-1446213 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517435 7:1446210-1446232 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517444 7:1446229-1446251 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517453 7:1446248-1446270 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517483 7:1446335-1446357 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517492 7:1446354-1446376 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517522 7:1446441-1446463 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019543095 7:1560246-1560268 CAGGGACAGGAGCAGGGAGGTGG - Intronic
1019801094 7:3089021-3089043 CTGGGAAAGGGAGTGGGAGGGGG - Intergenic
1020080179 7:5282677-5282699 GAGGAGGAGGAATGGGGAGGAGG + Intronic
1020103805 7:5411238-5411260 AAAGAAAAGGAAGGGGGAGGTGG + Intronic
1020547682 7:9554389-9554411 CATGGAATGGAAGGGGGAGTTGG - Intergenic
1020770986 7:12394368-12394390 CAGGAAAACGAATGGGATGGAGG + Intronic
1020836559 7:13159792-13159814 GAAAGAAAGGAATGGGGAAGAGG + Intergenic
1021991520 7:26145987-26146009 TAGGGCAAGGTATGGGGAAGGGG - Intergenic
1021998290 7:26201510-26201532 AAGGGGAGGGAAGGGGGAGGCGG - Exonic
1022021007 7:26399093-26399115 CTGGGGAAGGAAAGAGGAGGCGG - Intergenic
1022028358 7:26469123-26469145 CAGTCAAAGGATTGGGAAGGGGG - Intergenic
1022256212 7:28661056-28661078 GAGGGTAGGGAATGGGGTGGTGG + Intronic
1022359454 7:29644311-29644333 CGGGGTAAGGGATGGGGATGAGG + Intergenic
1022473371 7:30694999-30695021 CTGGGAAGAGAAAGGGGAGGAGG + Intronic
1022506131 7:30909641-30909663 CAGGGACAGGTGAGGGGAGGAGG + Intergenic
1023160399 7:37291924-37291946 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1023170585 7:37386806-37386828 CAGGGAAGGGCTTGGGGAGGAGG - Intronic
1023602429 7:41892897-41892919 AAGGAAAACAAATGGGGAGGAGG + Intergenic
1023623542 7:42095519-42095541 AAGGGAAATGAATGGGATGGAGG + Intronic
1023771451 7:43560443-43560465 CGGGGAAAGGGACAGGGAGGAGG + Intronic
1023879604 7:44310785-44310807 GAGGGAAGGGAATGGGGAGTCGG + Intronic
1023994162 7:45148653-45148675 CAGGGAAAGAGATGGGGAGATGG - Intergenic
1024028353 7:45433335-45433357 GAGGGAGAGGAAGGAGGAGGGGG - Intergenic
1024072565 7:45798755-45798777 GAGGGGAGGGAAGGGGGAGGTGG + Intergenic
1024304963 7:47921893-47921915 GGGGGAAAGGGAAGGGGAGGGGG - Intronic
1024643870 7:51355438-51355460 AAGGGGATGGAATGGGAAGGTGG + Intergenic
1024683876 7:51723705-51723727 CAATGAAAGGAAAGGGAAGGGGG - Intergenic
1025249423 7:57342104-57342126 CAGGGACAGGGATGGGAAGGAGG + Intergenic
1025945392 7:66100443-66100465 GAGGAAAAAGAATGAGGAGGAGG + Intronic
1025959664 7:66208936-66208958 CAAGGAAAGGTAAGGGGAGATGG + Intronic
1025979698 7:66395062-66395084 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1026154979 7:67818843-67818865 AAGGGAAAGGAAAGGGAAGGAGG - Intergenic
1026155022 7:67818949-67818971 AGGGGAAAGGAATGGAGGGGAGG - Intergenic
1026155073 7:67819073-67819095 AAAGGAAAGGAAAGGAGAGGAGG - Intergenic
1026308827 7:69166253-69166275 GGGGGAAGGGGATGGGGAGGGGG + Intergenic
1026378529 7:69775943-69775965 CAGAGAAAGAAGTGGGGTGGGGG - Intronic
1026461506 7:70619131-70619153 CCGGCAAGGGGATGGGGAGGGGG - Intronic
1026494203 7:70888429-70888451 TAGAGAGAGGAAGGGGGAGGGGG + Intergenic
1026502638 7:70956176-70956198 AAGGGAAAAGAGTGGGCAGGAGG - Intergenic
1026817012 7:73521524-73521546 CGGGGAAGGTAATGGGGATGGGG + Intronic
1026942346 7:74294505-74294527 GAGGGAAATGAATCGGGAGCGGG - Intronic
1027397023 7:77767076-77767098 AAGGGAAAGGGAAGGGGAAGGGG - Intronic
1027545998 7:79528467-79528489 CAGGGAAAGAAGAGGGGATGAGG - Intergenic
1027633305 7:80636164-80636186 CAGAGAACGGAGAGGGGAGGAGG + Intronic
1027647646 7:80823920-80823942 CAGAGAGAGAAATGGGGAGTAGG + Intronic
1027825426 7:83108700-83108722 CAGGTAAAAAAATGAGGAGGTGG - Intronic
1027878416 7:83801174-83801196 CAAGAATGGGAATGGGGAGGTGG + Intergenic
1028309533 7:89313804-89313826 CAAGGAAAAGAAAGGGAAGGTGG - Intronic
1028398846 7:90403304-90403326 CAGAGAAAGGGAAGGGCAGGAGG + Intronic
1028535463 7:91886860-91886882 CAGGGAGGGGCAGGGGGAGGGGG - Intergenic
1028655975 7:93207463-93207485 GAGGGAAAGGGAAGGGGAGAGGG + Intronic
1028757623 7:94455977-94455999 AAGGGAAAGGGAAGGGGAAGGGG + Intergenic
1028995280 7:97093291-97093313 CAGGGACAGGCCTGGGGAGGTGG - Intergenic
1028997190 7:97114185-97114207 GTGAGAAAGGAGTGGGGAGGGGG - Intergenic
1029099533 7:98117255-98117277 CAAGGAAAGGGAAGGGGAAGAGG - Intronic
1029107222 7:98188148-98188170 CAGGGAAGGGGAGGGAGAGGAGG - Intronic
1029350851 7:100011853-100011875 CAGGGAGAGGGAAGGGGAGGAGG + Intergenic
1029367671 7:100127141-100127163 CCGCGAACGGAATGGGGCGGGGG + Intronic
1029469156 7:100742871-100742893 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1029547125 7:101216515-101216537 CTGGGAGAGGAGTGGCGAGGGGG - Exonic
1029938514 7:104454250-104454272 AAGTGAAAGGAATGTGGAGGTGG + Intronic
1030036500 7:105411770-105411792 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1030100553 7:105941594-105941616 TAGGGAAAGGCCTGGGAAGGGGG - Intronic
1030288097 7:107847473-107847495 GAGGGAAAGGGAGAGGGAGGGGG - Intergenic
1030360085 7:108586620-108586642 AAGGAAAGGGAATGGGGACGGGG - Intergenic
1030382751 7:108831472-108831494 CAGTGAAAGAAAGGGGGAAGTGG - Intergenic
1030638258 7:111974575-111974597 AAGGAAAAGGGATGGGGAGGAGG + Intronic
1030706508 7:112698047-112698069 GAGGGAGAGGGAGGGGGAGGAGG + Intergenic
1030831286 7:114225309-114225331 AAAGGAAAGAAAGGGGGAGGGGG - Intronic
1030971409 7:116062018-116062040 TAGGGGAAGGGATGGGAAGGAGG - Intronic
1031016703 7:116583219-116583241 CAGGGCAAAGAAAGAGGAGGAGG + Intergenic
1031156397 7:118116509-118116531 CATGGAAAGGAAAGGGGAAAAGG + Intergenic
1031214805 7:118877113-118877135 AGGGGAAAGGAAAGAGGAGGGGG + Intergenic
1031368970 7:120940388-120940410 CAGGGAACGGAAGGGAGATGAGG + Intergenic
1031511323 7:122653872-122653894 GAGGGAAAGAAATGAGGAAGTGG - Intronic
1032189322 7:129754544-129754566 CTGGGGAAGGGTTGGGGAGGGGG + Intronic
1032262324 7:130347438-130347460 AAGGGAAAGGAATGGGGAGGGGG - Intronic
1032350609 7:131159560-131159582 CTGGGAAGGGAAGGGGGAGTGGG + Intronic
1032492396 7:132333388-132333410 CAGGAAGAGGAAGAGGGAGGTGG + Intronic
1032612814 7:133434044-133434066 CATGTAAAGGAATCTGGAGGAGG + Intronic
1032648748 7:133854773-133854795 AAGGAAAAGGGATGGTGAGGAGG - Intronic
1032720912 7:134550291-134550313 CAGGGTAAGGGATGGGGATGAGG - Intronic
1032856010 7:135834130-135834152 GAGGGAAAGGACAGGAGAGGTGG - Intergenic
1033152153 7:138924882-138924904 CAGAGAAAGGAAAGGGGTTGGGG + Intronic
1033174522 7:139112119-139112141 AAGGGAAAGGAAAGGGGAAAAGG + Intergenic
1033219923 7:139521049-139521071 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1033304163 7:140212287-140212309 CAGGGAGAGGACTAGGGTGGAGG - Intergenic
1033705765 7:143883801-143883823 AAAGGAAAGAAATGGGGAGCGGG - Intronic
1033733035 7:144196585-144196607 CAGGGAGAGGGACAGGGAGGGGG - Intergenic
1033743887 7:144295165-144295187 CAGGGAGAGGGACAGGGAGGGGG - Intergenic
1033750014 7:144354402-144354424 CAGGGAGAGGGACAGGGAGGGGG + Intergenic
1033890430 7:146006398-146006420 CAGGGGGAGGATGGGGGAGGAGG - Intergenic
1034014388 7:147566342-147566364 AGGGGAAAGGAAGGGGGAGGGGG + Intronic
1034034313 7:147802775-147802797 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1034062506 7:148106017-148106039 CAGCAGAAGGAATGGAGAGGAGG + Intronic
1034065873 7:148136066-148136088 AAGGGAGAGGGAGGGGGAGGTGG + Intronic
1034091784 7:148370635-148370657 CAGGGAAGGGCAGGGGTAGGGGG - Intronic
1034271200 7:149804124-149804146 CAGGGTACAGAATTGGGAGGAGG - Intergenic
1034278352 7:149834356-149834378 CAAGGAAAGCAATTGGGAGGTGG - Intergenic
1034518184 7:151598293-151598315 CTGGGGAGGGAATGGGGTGGGGG + Intronic
1034562551 7:151890541-151890563 CAGGGAGGGGAATGTGGAGAGGG + Intergenic
1034695959 7:153053944-153053966 GAGGGTGAGGAATGGGGAGTTGG - Intergenic
1035023886 7:155814426-155814448 CGGGGAAAGACAGGGGGAGGAGG - Intergenic
1035034438 7:155885864-155885886 AAGGAAAAGGATGGGGGAGGAGG - Intergenic
1035208483 7:157310323-157310345 AAGGGAAAGGAATGCAGAGTCGG + Intergenic
1035257540 7:157640944-157640966 CAGTAAAAGGAATGGTGATGGGG + Intronic
1035263103 7:157674166-157674188 CAGGGGAGGGAAGGAGGAGGCGG + Intronic
1035435853 7:158858829-158858851 AAGGGAGGGGAAAGGGGAGGGGG - Intronic
1035435897 7:158858924-158858946 GGAGGAAAGGAAAGGGGAGGGGG - Intronic
1035535932 8:391312-391334 CAGGGAAGGGAAAGAGCAGGTGG - Intergenic
1035917969 8:3645483-3645505 CAGTGGAAGAAATGGGGAAGGGG + Intronic
1036096165 8:5726563-5726585 CAGGGAAATGAATTGCAAGGAGG + Intergenic
1036550639 8:9812595-9812617 CAGGGACTGGGATGGGGATGAGG - Intergenic
1036744292 8:11393084-11393106 GAGGGGAAGGCATGGTGAGGAGG - Intronic
1037578602 8:20231146-20231168 TGGGGAAAGGAAGTGGGAGGAGG - Intergenic
1037642669 8:20761982-20762004 CAAGGCAAGGCATGGAGAGGTGG - Intergenic
1037803645 8:22048280-22048302 AAGGGAAAGGGGTGGGGAGGCGG - Exonic
1037902996 8:22698839-22698861 AAGGGAAAGAAAAGGGGTGGTGG + Intergenic
1038042631 8:23737979-23738001 AAGGGGAAGGGGTGGGGAGGAGG - Intergenic
1038067041 8:23974168-23974190 TAGGGATAGAAATGGAGAGGAGG + Intergenic
1038084293 8:24176126-24176148 CAGGGTAAGGAATGGACAGGAGG - Intergenic
1038423795 8:27451679-27451701 CAGGGAGAGGAATGGGGTGGAGG - Intronic
1038699357 8:29835526-29835548 CAGGGGATGGTGTGGGGAGGAGG - Intergenic
1038720313 8:30028962-30028984 CAGAGACAGGCATGGGAAGGAGG - Intergenic
1038795238 8:30703782-30703804 CAGGGGAAGGAAGAAGGAGGAGG + Intronic
1038929592 8:32178038-32178060 GAGGGCAAGGCAAGGGGAGGGGG + Intronic
1039036111 8:33360827-33360849 CAAGCAAACAAATGGGGAGGGGG + Intergenic
1039306948 8:36273129-36273151 CAGGGCATGCAATGGGGATGCGG - Intergenic
1039432182 8:37533570-37533592 AGGGGAAAAGGATGGGGAGGAGG - Intergenic
1039788876 8:40858253-40858275 CAGGGAAATCAATGGGGGTGAGG + Intronic
1039920521 8:41891040-41891062 CAGAGAGAGCAATGGGGTGGGGG + Intronic
1039990229 8:42481499-42481521 CAGGGAGAGACATGGGAAGGAGG + Intronic
1040640728 8:49331656-49331678 AAGGGAAAAGAATGATGAGGAGG + Intergenic
1040648232 8:49423173-49423195 CAAGGAAAGGAAAGAGGAGTGGG - Intergenic
1040698291 8:50029493-50029515 CAGGAAGAGAAGTGGGGAGGTGG - Intronic
1040818469 8:51533493-51533515 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1041107825 8:54459030-54459052 CAGTGGAAGGAAGGGGGAGAGGG - Intronic
1041513765 8:58677268-58677290 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1041697461 8:60751297-60751319 AAGTGAAAGAAATGGGGAGGGGG - Intronic
1042083197 8:65078482-65078504 AAGGGAAAGGACTGGGATGGAGG + Intergenic
1042290210 8:67163052-67163074 CAGTGAAAGGAATGGACAGAGGG + Intronic
1042942185 8:74118737-74118759 GAGGGAAAGGAGAGGAGAGGAGG - Intergenic
1042949785 8:74189149-74189171 AAGGGAAAGAAAGGAGGAGGAGG - Intergenic
1042993846 8:74671153-74671175 CAGGGAAAGGAAGTGGGAAAAGG + Intronic
1043045234 8:75314786-75314808 CAGGGATAGGGATAGAGAGGAGG - Intergenic
1043053621 8:75409885-75409907 CATGGAGTGGAATGGGGAGGGGG - Intronic
1043267391 8:78283551-78283573 CAGGGCAAAGAATAGGAAGGAGG - Intergenic
1043314929 8:78908734-78908756 GAGGAAAAGGGAGGGGGAGGAGG + Intergenic
1043798842 8:84580448-84580470 CAGAGAAAGGAATGGGGTGTGGG + Intronic
1043816054 8:84802886-84802908 CTGGGAATGGAATGCAGAGGGGG + Intronic
1043908435 8:85833326-85833348 AAGGGAAGGGAAGGGGGGGGAGG - Intergenic
1044289289 8:90448511-90448533 AAGGGAGAGGAATCTGGAGGAGG - Intergenic
1044722811 8:95167434-95167456 CAGGGAAGGGGGTGTGGAGGAGG - Intergenic
1045057879 8:98384956-98384978 GAAAGAAAGGAATGTGGAGGAGG - Intergenic
1045141248 8:99286012-99286034 AGAGGAAAGGGATGGGGAGGAGG - Intronic
1045195480 8:99926586-99926608 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1045412080 8:101929530-101929552 GAGGGAAAGGAAAGGGGAGGGGG + Intronic
1045588551 8:103566234-103566256 CAGCTACAGGAATGGGGAAGGGG - Intronic
1045595657 8:103651716-103651738 CAGAGAAAGGAATGGGAGGTGGG - Intronic
1045695964 8:104809252-104809274 CAAGGAAAGGGATGAGGAAGAGG - Intronic
1045757085 8:105556689-105556711 AAGGGAAGGGAAGGGGGAAGGGG - Intronic
1045865023 8:106855073-106855095 CAGGTAAAGCAATGTGGAGAGGG + Intergenic
1046092877 8:109524249-109524271 CAGGGAAAAAACTGGGGAGAGGG - Intronic
1046342956 8:112882532-112882554 AAGGGAAAAGAGTGGGAAGGAGG - Intronic
1046596965 8:116272591-116272613 CAAGGACAGGAATAGGGAGTTGG + Intergenic
1046934724 8:119874757-119874779 CAGGGATGGGAATGGCAAGGGGG - Intronic
1046966076 8:120167208-120167230 CAGTGGAAAGAAAGGGGAGGAGG + Intronic
1047435658 8:124833752-124833774 CTAAGAGAGGAATGGGGAGGGGG - Intergenic
1047782703 8:128123088-128123110 GAGAGAAAGGAAAGGGGAAGAGG - Intergenic
1048451228 8:134535489-134535511 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1048500436 8:134970248-134970270 CATGGAAAGGAGGGGGGAGTAGG + Intergenic
1048548789 8:135414335-135414357 GAGAGAAAGGCATGGGGAGGAGG + Intergenic
1048722872 8:137347086-137347108 CTGGGAAAGGAAAGAGGAAGAGG - Intergenic
1048879822 8:138863158-138863180 CAAGGAAAGAAACGGGGAGCCGG - Intronic
1048986808 8:139739156-139739178 CTGGGGAAGGCATGGGGAAGAGG - Intronic
1049091989 8:140522696-140522718 CAGAGAGAGGGAGGGGGAGGGGG + Intergenic
1049122015 8:140747630-140747652 AGGGGAGAGGAAGGGGGAGGAGG + Intronic
1049171911 8:141166825-141166847 CAGGGCCAGGGATGGGGAGGGGG + Intronic
1049262905 8:141649266-141649288 CAGCGCAAAGAATGGGGAGGAGG - Intergenic
1049311769 8:141937354-141937376 GAGGGAAGGGAAGAGGGAGGAGG - Intergenic
1049311795 8:141937419-141937441 CAGGGAAGGAAAGAGGGAGGAGG - Intergenic
1049531790 8:143158923-143158945 CTGGGCAGGGCATGGGGAGGAGG + Intronic
1049686533 8:143941419-143941441 CAGGGTCAGGAATGGGGCAGGGG + Intronic
1049719196 8:144107849-144107871 CACCGAAAAGAATGGTGAGGGGG + Exonic
1049759024 8:144323527-144323549 CATGGAACGGCATGGGGAGGTGG + Intronic
1049761565 8:144334140-144334162 GCGGGAAGGGAATGGGGCGGCGG + Intronic
1049861963 8:144904860-144904882 TAGGGCAAGGCATGGGGAGAGGG + Intergenic
1049873773 8:145002342-145002364 GAAGGAAAGGAATAGGCAGGAGG - Intergenic
1049948057 9:617344-617366 TAGGAGAAGGATTGGGGAGGAGG + Intronic
1050143248 9:2538619-2538641 GAGGGAAGGGAAGGTGGAGGCGG - Intergenic
1050741314 9:8823690-8823712 AAGGGAAAGGAAAGGAAAGGCGG + Intronic
1050910202 9:11058670-11058692 CAGCGAAAGCAATGGGGCTGTGG + Intergenic
1050967635 9:11827205-11827227 CTGGGAAAGGTAGGGAGAGGTGG + Intergenic
1051288673 9:15523326-15523348 AAGGGTTAGGAATTGGGAGGAGG - Intergenic
1051343094 9:16129206-16129228 CAGGGACAGGACTGGGCAGAGGG + Intergenic
1051667430 9:19478199-19478221 CAGGGGAAGGAACCGGGAGAGGG + Intergenic
1051677025 9:19568940-19568962 CACGGAAAGAAAGGGGGAGAAGG - Intronic
1051833414 9:21307385-21307407 GAGATAAAGGAATGGGGAAGAGG + Intergenic
1052022150 9:23537898-23537920 AAGGGTAAGGGAGGGGGAGGGGG + Intergenic
1052400697 9:27996598-27996620 CAGGGAAAGGTAGTGGGAAGAGG + Intronic
1052493025 9:29190039-29190061 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1052608165 9:30732533-30732555 CAGTGAAATGAATGGGGAGCTGG + Intergenic
1052960220 9:34289300-34289322 CAAGCAATGGAATGGGGAGTGGG - Intronic
1053004740 9:34596962-34596984 CAGGGAGAGGGAGTGGGAGGTGG + Intergenic
1053020230 9:34689415-34689437 CAGGAATAGGAAGGGGGAGGTGG - Intergenic
1053364256 9:37511572-37511594 CAGGGAGAGCTATGTGGAGGTGG + Exonic
1053479048 9:38402553-38402575 CTGGGAAGGGAATAGGGAAGTGG + Intergenic
1053504505 9:38630000-38630022 GAGGCAAATGCATGGGGAGGTGG - Intergenic
1053568760 9:39281845-39281867 GAAGATAAGGAATGGGGAGGGGG - Intronic
1053684010 9:40505027-40505049 CATGGAAAGGACATGGGAGGAGG + Intergenic
1053834729 9:42122876-42122898 GAAGATAAGGAATGGGGAGGGGG - Intronic
1053933984 9:43133312-43133334 CATGGAAAGGACACGGGAGGAGG + Intergenic
1054090395 9:60840810-60840832 GAAGATAAGGAATGGGGAGGGGG - Intergenic
1054111806 9:61116367-61116389 GAAGATAAGGAATGGGGAGGGGG - Intergenic
1054128384 9:61337162-61337184 GAAGATAAGGAATGGGGAGGGGG + Intergenic
1054279711 9:63119926-63119948 CATGGAAAGGACACGGGAGGAGG - Intergenic
1054297105 9:63340491-63340513 CATGGAAAGGACACGGGAGGAGG + Intergenic
1054395125 9:64644999-64645021 CATGGAAAGGACATGGGAGGAGG + Intergenic
1054429772 9:65150199-65150221 CATGGAAAGGACATGGGAGGAGG + Intergenic
1054500611 9:65871333-65871355 CATGGAAAGGACACGGGAGGAGG - Intergenic
1054595810 9:67064652-67064674 GAAGATAAGGAATGGGGAGGGGG + Intergenic
1054728965 9:68681430-68681452 TAGGGAAAGAAATGAGGAAGAGG + Intergenic
1054793882 9:69280616-69280638 CAGGAGAAGGAAGGGGGAAGGGG + Intergenic
1054929431 9:70620257-70620279 CATGGAAAGGGAAGGGGAAGTGG + Exonic
1055162965 9:73154045-73154067 AAGGGAAGTGAATGTGGAGGAGG + Intronic
1055948083 9:81709510-81709532 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1056137733 9:83646546-83646568 AAGGGAAGGGAAGGGGGAAGAGG + Intergenic
1056296139 9:85194878-85194900 TGGGGAAAGTAGTGGGGAGGTGG + Intergenic
1056540546 9:87567396-87567418 TAGGGAAGGGAATGGGGCGTGGG + Intronic
1056773971 9:89498160-89498182 AGGGGAAGGGAAAGGGGAGGAGG - Intergenic
1056795249 9:89654786-89654808 CAGGGCAAGGCAAGGGGAGCAGG - Intergenic
1057151914 9:92803681-92803703 GAGGCAAATGCATGGGGAGGTGG + Intergenic
1057294921 9:93829359-93829381 CAGGGAATGCCATGAGGAGGTGG + Intergenic
1057567551 9:96178675-96178697 CAGGGCATGGGATGGGAAGGAGG + Intergenic
1057721273 9:97534015-97534037 GAGAAAAAGGGATGGGGAGGGGG + Intronic
1057805211 9:98215038-98215060 CAGGGACAGGATTGGATAGGGGG - Intronic
1057921059 9:99097179-99097201 CAGGTAAAGCAGTGGGGAGTTGG + Intergenic
1057942765 9:99299232-99299254 CAGGGAAAGGGAGGGCCAGGTGG + Intergenic
1058215866 9:102232418-102232440 CAGTGAAATGGATGGGGAGCCGG + Intergenic
1058414594 9:104774368-104774390 CATGGAAAAGAATGCTGAGGAGG - Intronic
1058504344 9:105653352-105653374 GTGGGAAAAGAATGGGGACGGGG + Intergenic
1058601351 9:106674232-106674254 CAGAGGAGGGAAGGGGGAGGCGG - Intergenic
1058640526 9:107079597-107079619 AAGGGAGAGGGAAGGGGAGGGGG + Intergenic
1059001314 9:110351317-110351339 TAGGGAAACCAATGGGGTGGGGG + Intergenic
1059269521 9:113063116-113063138 CAGGGAAAGGAAAGGAGAGCCGG + Intergenic
1059270653 9:113068563-113068585 CAGGGAAAGGAAAGGAGAGCCGG + Intergenic
1059271788 9:113074010-113074032 CAGGGAAAGGAAAGGAGAGCCGG + Intergenic
1059272922 9:113079457-113079479 CAGGGAAAGGAAAGGAGAGCCGG + Intergenic
1059274057 9:113084899-113084921 CAGGGAAAGGAAAGGAGAGCCGG + Intergenic
1059427575 9:114230828-114230850 TATGGAAAGGAATGGGGATAGGG + Intronic
1059632727 9:116141959-116141981 GAGGGTAAGAGATGGGGAGGGGG + Intergenic
1059651889 9:116322869-116322891 TAGGAAAAGGAATGGGGAGGAGG - Intronic
1059742213 9:117163052-117163074 CAGAGAAAGGTATGAGGAGCAGG - Intronic
1059773094 9:117446445-117446467 CAGGGAAAGGAAACAGGAAGGGG - Intergenic
1059928192 9:119233791-119233813 TAGGGAGAGGAATGGGGTAGTGG - Intronic
1060185867 9:121563821-121563843 GAGGGAAATGGATTGGGAGGTGG + Intergenic
1060234157 9:121850541-121850563 AAGGGGGAGGAGTGGGGAGGTGG + Intronic
1060384901 9:123216162-123216184 CAGGCAAAGGATTAGGAAGGGGG - Intronic
1060479365 9:124009007-124009029 AAGGGAAAGGCAAGGGGTGGGGG - Intronic
1060850268 9:126869203-126869225 CAAGGAAAGGGATGGAGATGGGG - Intronic
1060901638 9:127262917-127262939 CTGGGAAAGGAAGAGGGAAGTGG + Intronic
1060928685 9:127474002-127474024 CTGGGAATGGAAGGGGGCGGTGG + Intronic
1060944546 9:127562187-127562209 CGGGGAGAGGAAGTGGGAGGAGG - Intronic
1060975975 9:127765254-127765276 CAGGGAAGGGAATGTGGTAGTGG - Intronic
1061000539 9:127899715-127899737 CGGGGAAGGGAAAGGGGAGGCGG + Intronic
1061237532 9:129351485-129351507 GAGGAAAAGGAAGGGGGAAGAGG + Intergenic
1061307363 9:129739815-129739837 CAGGAAAAGGAAGGGGTAGATGG + Exonic
1061357946 9:130120477-130120499 CAGGGAAGGAAATGCGGATGGGG - Intronic
1061395728 9:130342449-130342471 CTGGGGAGGGACTGGGGAGGTGG + Intronic
1061408055 9:130403489-130403511 CAGGAGAAGGGTTGGGGAGGGGG - Intronic
1061661165 9:132131287-132131309 CAGGAGAAGGGATGGGGAGCAGG + Intergenic
1061791294 9:133060678-133060700 CAGGGAGAGGAAGGAGGTGGGGG - Intergenic
1061793118 9:133068906-133068928 CCGGGAAAGCACTGGCGAGGGGG + Intronic
1061794958 9:133081157-133081179 CAGGGAGAGGAAGGAGGTGGGGG - Intronic
1061795721 9:133084690-133084712 CCGGGAAAGCACTGGCGAGGGGG + Intronic
1061835683 9:133328050-133328072 CAGGGAAAGGATCGGGGTGCAGG - Intergenic
1061865659 9:133490755-133490777 CAGGGAGAAGAAGGAGGAGGAGG + Intergenic
1061932487 9:133840412-133840434 CAGGGGCAGGAGTGGGGAGTGGG - Intronic
1062571372 9:137187124-137187146 CAGGGCAAGGAATGTCGACGAGG + Intronic
1062694609 9:137866983-137867005 TAGAGGAAGGAATGGGGTGGAGG - Intronic
1062744650 9:138203576-138203598 CAAGGAAGAGAATGAGGAGGGGG + Intergenic
1203526030 Un_GL000213v1:88508-88530 GAGGGAGAGGAATGGGAAGTTGG + Intergenic
1185449560 X:275222-275244 CAGGGGGAGGAAGGAGGAGGGGG + Intergenic
1185490934 X:516519-516541 CAGAGAAAGGAAAGAGGAGAGGG - Intergenic
1185511526 X:668006-668028 AAGGGGAAGGAGAGGGGAGGAGG - Intergenic
1185581213 X:1212918-1212940 GAGGGAAGGGAATGGAGGGGAGG - Intergenic
1185581348 X:1213200-1213222 GAGGAAAGGGAAGGGGGAGGGGG - Intergenic
1185604447 X:1359843-1359865 CAGAGAAAGAGATGGGGAGGGGG - Intronic
1185712376 X:2314370-2314392 GAGGGAAAGGAATGGAGGGAAGG + Intronic
1185714463 X:2330126-2330148 GAGAGAAAGGAAGGAGGAGGAGG + Intronic
1185721328 X:2384171-2384193 CAGGGAGAGGAATGCCAAGGTGG + Intronic
1186423952 X:9448929-9448951 AAGAGAAGGGAATGGAGAGGTGG - Intergenic
1186676855 X:11826921-11826943 CAGAGAAAGGTATGAGGAGGAGG + Intergenic
1186684924 X:11916108-11916130 AAGGGAAGTGGATGGGGAGGGGG + Intergenic
1186829195 X:13373754-13373776 CATGTAAAGGAATTTGGAGGTGG + Intergenic
1187330897 X:18338575-18338597 AGGGGCAAGGAATGGGGAGTTGG + Intronic
1187426827 X:19185355-19185377 GAGAGAAAGGAGAGGGGAGGAGG - Intergenic
1187493271 X:19772740-19772762 CAGGGAAAAGGGTCGGGAGGAGG + Intronic
1188085287 X:25895507-25895529 CAGGGAAAGGAAAGGGGAGAAGG + Intergenic
1188112579 X:26209459-26209481 CACGGACAGGAAAGGGGAGTGGG - Intergenic
1188214138 X:27457837-27457859 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1188554363 X:31395386-31395408 CAGGGAAAACAAAGGGGATGGGG - Intronic
1188673661 X:32912082-32912104 GAGGAGAAGGAATGGGGAGGAGG + Intronic
1188981789 X:36733466-36733488 CAGGGGGAGGACTGGGTAGGGGG - Intergenic
1189022041 X:37350713-37350735 GAGGGAAAGGGGTGGAGAGGAGG - Intronic
1189076842 X:37925018-37925040 CTGGGAAGGGTAGGGGGAGGGGG - Intronic
1189113536 X:38320196-38320218 AAGGGAAAGGTATGGAGAGGTGG + Intronic
1189116065 X:38343879-38343901 CAGGAAAAGGGATGGAGAGGGGG + Intronic
1189398913 X:40647235-40647257 CTGGGACAGGAACGGGGATGAGG + Intronic
1189577967 X:42375541-42375563 CAGGGAACGAGCTGGGGAGGTGG - Intergenic
1189782747 X:44531696-44531718 CAGGAAAAAGGTTGGGGAGGGGG + Intronic
1190106497 X:47564764-47564786 CATGGAAAGGAATGAGTGGGAGG - Intronic
1190174569 X:48138560-48138582 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1190244591 X:48682956-48682978 AAGGGTAAGGGATGGGGAAGTGG + Intronic
1190415700 X:50178480-50178502 CCCAGAAAGGAATGGTGAGGTGG - Intergenic
1190561944 X:51694963-51694985 AAGGGAAAAGGATGGGGAAGGGG + Intergenic
1190584294 X:51922703-51922725 GAGGGAAAGGGATGGGGAAGGGG - Intergenic
1190618807 X:52264926-52264948 CTTGGAAAGGAGTAGGGAGGTGG + Intergenic
1190625809 X:52337455-52337477 CTTGGAAAGGAGTAGGGAGGTGG - Intergenic
1190988660 X:55522945-55522967 CAGGGAAAGGAGTTGAGAAGAGG + Intergenic
1191310955 X:59064737-59064759 AAAGGAAAGGAAAGGAGAGGAGG + Intergenic
1191471450 X:61212220-61212242 AAAGGAAAGGAAAGGAGAGGAGG + Intergenic
1191601042 X:63007369-63007391 CAGGGGAAAGCATGGGAAGGGGG + Intergenic
1191871712 X:65751826-65751848 CAGGAGAAGGAATGGGAATGGGG - Intergenic
1192345745 X:70303861-70303883 CAGGGAAAGGGGTGGGAATGGGG - Intronic
1192366672 X:70479602-70479624 CATGGAAGGGGATGGGGGGGTGG - Intronic
1192717955 X:73663760-73663782 CAGGGAAAAGAAAGGGGAAAGGG - Intronic
1192738950 X:73874949-73874971 CCAGGGAGGGAATGGGGAGGTGG + Intergenic
1192771323 X:74195279-74195301 CAGGCAATGGTATGGGGCGGGGG + Intergenic
1193804884 X:85983381-85983403 CAGTGAAAGGAAGGAGAAGGTGG + Intronic
1193998365 X:88394448-88394470 AAGGGAAAGGGATGAGGATGTGG - Intergenic
1194410540 X:93552551-93552573 GAAGGAAAGAAATGGGGAGGTGG - Intergenic
1195086427 X:101418262-101418284 CAGGGAAAGGGACAGGGAAGAGG + Intergenic
1195119764 X:101738445-101738467 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1195161834 X:102179211-102179233 CATGGAAAGGAAAGGGGAAAGGG - Intergenic
1195252484 X:103063010-103063032 TATGGAAAGGATTGGGGAGGAGG - Exonic
1195278683 X:103309703-103309725 TATGGAAAGGATTGGGGAGGAGG - Exonic
1195300894 X:103528793-103528815 CAGGGTCAGGAATGGGGCTGGGG + Intergenic
1195527666 X:105910610-105910632 CAGGGCATGGAGTGAGGAGGTGG + Intronic
1195647562 X:107249764-107249786 AAGGGGATGGAATGGGAAGGTGG + Intergenic
1196759796 X:119190805-119190827 AAAGGAAGGGAGTGGGGAGGAGG + Intergenic
1197157033 X:123282301-123282323 CAGTGAAGGGAAAGAGGAGGGGG - Intronic
1197241492 X:124127361-124127383 CAAGGAATGGAGTGGGAAGGTGG - Intronic
1197452765 X:126640742-126640764 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1197902779 X:131392147-131392169 CAGGAAAGAGAGTGGGGAGGGGG - Intronic
1197998912 X:132411646-132411668 TGGGGACAGGAATGGGGAGACGG - Intronic
1198233595 X:134716110-134716132 GCTGGAAAGGAAAGGGGAGGAGG - Intronic
1198242029 X:134796598-134796620 AAGGGAGAGGAAGGGGGCGGAGG + Intronic
1198520667 X:137449246-137449268 CAGTGAAAGGAAAAGGGAGAAGG - Intergenic
1198549218 X:137727015-137727037 CTGTGAAAGAAATGGGAAGGGGG + Intergenic
1198560760 X:137847730-137847752 CAGGAAAATGCATGGGGTGGGGG + Intergenic
1198562697 X:137867944-137867966 CAGGGAAAGGAGAGGGGCAGAGG + Intergenic
1198684362 X:139211908-139211930 CTGTGAAAGGAAGTGGGAGGAGG - Intronic
1198686058 X:139229236-139229258 CAGGGGCAGGAATGAGGAGTGGG - Intergenic
1199049302 X:143218213-143218235 TAGAAAAAGGAGTGGGGAGGAGG - Intergenic
1199067185 X:143433290-143433312 AGGGGTAAGGTATGGGGAGGCGG - Intergenic
1199186843 X:144925096-144925118 TGGGGCAAGGCATGGGGAGGAGG - Intergenic
1199225795 X:145371814-145371836 CAGGGCAAGGTATGGGAAAGGGG - Intergenic
1199408903 X:147496383-147496405 CATGGAAAGGAGTGGGGGGAGGG - Intergenic
1199435122 X:147804471-147804493 GAGGGAAGGGAAAGGGGTGGGGG + Intergenic
1199451337 X:147981702-147981724 CAGGGAAATGCTGGGGGAGGGGG + Intronic
1199474488 X:148230918-148230940 GAGGGAGGGGGATGGGGAGGGGG - Intergenic
1199484659 X:148334591-148334613 CAGGGAAAGGAATATGGGGTGGG - Intergenic
1199511896 X:148631677-148631699 CATTGAAAGGCAGGGGGAGGAGG + Intronic
1199618806 X:149680931-149680953 CAGGGAAAAGAAAGGGGAAAGGG - Intergenic
1199623836 X:149722318-149722340 CAGGGAAAAGAAAGGGGAAAGGG + Intergenic
1199717776 X:150518516-150518538 CAGGAGAGGGGATGGGGAGGTGG + Intergenic
1199812580 X:151365344-151365366 AAGGGAAGGGAAAGGGGAAGGGG - Intergenic
1199842981 X:151669542-151669564 CTAGGAAGGGAATGGGGAAGAGG - Intronic
1200021671 X:153216575-153216597 TAGGGAAAGGAGTTGTGAGGTGG + Intergenic
1200059147 X:153476486-153476508 CATGGAAGGGAAGGGGGAGGAGG + Intronic
1200330422 X:155291033-155291055 CTGGAAAAGGAATCTGGAGGTGG - Intronic
1200397452 X:155999509-155999531 CAGGGGTAGGGATGGGCAGGAGG - Intronic
1200834713 Y:7721975-7721997 CATGGAGAGGAATGGTGAGAGGG + Intergenic
1201119564 Y:10862571-10862593 AATGGAAAGGAATGAGGTGGAGG - Intergenic
1201122901 Y:10886792-10886814 AATGGAAGGGAATGGGGTGGAGG - Intergenic
1201283396 Y:12359930-12359952 CAGGGCAAGGGATGGGGATGAGG + Intergenic
1201332893 Y:12846940-12846962 CACCGAAAGGATTGGGGAGAGGG - Exonic
1201549923 Y:15209205-15209227 AAAGGAAAGGAAGGGGGAGCAGG + Intergenic
1201549956 Y:15209295-15209317 TAGGGAAGGGGATGGGGATGGGG + Intergenic
1201751494 Y:17436639-17436661 CAGTGAGATGAATGGGGAGATGG + Intergenic
1202038623 Y:20660298-20660320 CAGGGAAAGGAAAGGGGACAAGG + Intergenic
1202085448 Y:21132209-21132231 CAGGGCAAGGAATGAGGAAAGGG + Intergenic