ID: 1124230130

View in Genome Browser
Species Human (GRCh38)
Location 15:27937546-27937568
Sequence TACTGAGTGCTGAAAGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124230130_1124230133 20 Left 1124230130 15:27937546-27937568 CCACAATCTTTCAGCACTCAGTA 0: 1
1: 0
2: 0
3: 25
4: 168
Right 1124230133 15:27937589-27937611 CCATTTAGGTGTGCATATAATGG 0: 1
1: 0
2: 0
3: 5
4: 104
1124230130_1124230131 6 Left 1124230130 15:27937546-27937568 CCACAATCTTTCAGCACTCAGTA 0: 1
1: 0
2: 0
3: 25
4: 168
Right 1124230131 15:27937575-27937597 GTCTTTTTTTCTAACCATTTAGG 0: 1
1: 0
2: 1
3: 34
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124230130 Original CRISPR TACTGAGTGCTGAAAGATTG TGG (reversed) Intronic
901129566 1:6953896-6953918 TGCTCAGTGCTGAAAGACTGCGG - Intronic
902921614 1:19669320-19669342 GAGTGAGTGCTCACAGATTGTGG - Intronic
905625006 1:39483849-39483871 TACTTAGTGTTAAGAGATTGGGG + Intronic
906671514 1:47658519-47658541 GAGTCAGTGCTGAAAGATGGAGG - Intergenic
907701895 1:56796944-56796966 TTCTGAGTTCTGAAAGGTTGGGG - Intronic
907963862 1:59310152-59310174 TACTGACTGCTGTAAGATCTCGG - Intronic
908376499 1:63547461-63547483 TAGTGAGTGCTGAGGGAATGTGG + Intronic
908716674 1:67078184-67078206 ATCTGAGGCCTGAAAGATTGAGG + Intergenic
909432242 1:75602432-75602454 TTCTGAGTGGTTAAGGATTGTGG + Intronic
911968003 1:104391945-104391967 TACTAAGTCTTGAAAAATTGTGG - Intergenic
913704756 1:121408616-121408638 TACTGAGTAATCAAATATTGGGG + Intergenic
914444854 1:147741153-147741175 TACTGAGTGCAATCAGATTGAGG - Intergenic
915297991 1:154935254-154935276 TACTTAGTGATGAAAAATTCAGG + Intronic
916498470 1:165366345-165366367 TACTGGGTTCTAAAAGAATGAGG - Intergenic
917425996 1:174914621-174914643 TACTGTCTGCAGAAAGATTCTGG + Intronic
918661663 1:187095828-187095850 TATTGACTGCTGATAGATGGTGG + Intergenic
920000112 1:202791621-202791643 TACCGAGTGGTTAAAGGTTGGGG - Intronic
920600032 1:207315110-207315132 TACTGAGTGGGGAAAGAATAAGG + Intergenic
921433671 1:215091567-215091589 TCCTAAGTGCTGAAAGACAGTGG + Intronic
923073451 1:230587740-230587762 TACTCAGTGTTGAGAGATTGCGG + Intergenic
1063348787 10:5335922-5335944 CACTGAGGGCAGAAAGACTGAGG + Intergenic
1063511324 10:6647564-6647586 TAAAGAATGCTGAAAGATAGAGG + Intergenic
1063985163 10:11494367-11494389 GTCTGAGAGCTGAAAGATTTGGG - Intronic
1064426805 10:15236708-15236730 TACTGAATTCTGAAATATAGTGG + Intronic
1066258764 10:33708033-33708055 TCCTGAGTGCTGAAACCTAGGGG + Intergenic
1067007684 10:42680333-42680355 TGCTGAGTTGAGAAAGATTGTGG - Intergenic
1071467667 10:85956112-85956134 TAATGAGTGCTGAAAGAAAGAGG - Intronic
1072602854 10:96946772-96946794 CATTGAGTGCTCAAAGATAGTGG + Intronic
1074146763 10:110723571-110723593 TAATAAGTGCTGCAAGAATGTGG - Intronic
1074616811 10:115077868-115077890 TATTGAGTGCTGACTGATTGGGG + Intergenic
1075055136 10:119212803-119212825 TGCTGAGGGCTGTATGATTGAGG - Intronic
1075203253 10:120423933-120423955 TACTGAGTGCTTAAAGAATCTGG - Intergenic
1075879562 10:125839135-125839157 TTCTGAGTGCTGAACAGTTGAGG + Exonic
1079797909 11:24829478-24829500 TAACAAGTGCTCAAAGATTGTGG + Intronic
1081047348 11:38292673-38292695 AACAGAGTGCTGAAAGATCAGGG + Intergenic
1083110062 11:60397423-60397445 TACTGAGTGCTGGAAAATGTGGG + Intronic
1083116927 11:60469861-60469883 TGATGAGTGCTGCCAGATTGTGG + Exonic
1087081005 11:94171079-94171101 GACTGAGTCCTGAATGAATGAGG - Intronic
1088147315 11:106697353-106697375 AACTGACTGCTAAAAGATTAAGG + Intronic
1090595326 11:128314926-128314948 TTCTGAGGTCTGAAAGATGGTGG + Intergenic
1093007953 12:14071348-14071370 TACTGAGTAGTGATAGTTTGAGG - Intergenic
1095451143 12:42331476-42331498 AACTGAGGGCTGAGAGATTATGG - Intronic
1097497166 12:60354612-60354634 GACTGAGTCCAGAAAGGTTGAGG + Intergenic
1099911413 12:88838763-88838785 TTCTGAGATCTGAAAGATGGTGG + Intergenic
1100113671 12:91276480-91276502 CACTGAGTACTGAAAGAGTTTGG + Intergenic
1103067077 12:117907934-117907956 TACTGAGGGCTGGAAGATATTGG + Intronic
1103114329 12:118312862-118312884 TAATGAGTGTTGAAAGACTGTGG + Intronic
1103470042 12:121173133-121173155 TACTGAGTGATGACAGAGAGAGG + Intronic
1104616106 12:130270479-130270501 ACTTGAGTGCTCAAAGATTGTGG - Intergenic
1106587201 13:31067964-31067986 CACTGGGGGCTGTAAGATTGAGG - Intergenic
1108067841 13:46597031-46597053 TACAGAATTCTCAAAGATTGAGG - Intronic
1109841979 13:67930251-67930273 TACTTAGTGGTGAAATAATGTGG - Intergenic
1111794943 13:92907044-92907066 TACTGAGTGATTAAAGATTATGG + Intergenic
1112595991 13:100807227-100807249 TACTAAGTGCTGGTAGATGGTGG + Intergenic
1112789983 13:102992451-102992473 TACTGAGATGTGAAAGATGGAGG + Intergenic
1117693366 14:58333122-58333144 TACTGTGTGGGAAAAGATTGAGG + Intronic
1118896891 14:69952858-69952880 TAGGGAGTGCTGTAAGACTGTGG - Intronic
1122317006 14:100831805-100831827 TACTTAGTGCTGAGACCTTGGGG + Intergenic
1123220274 14:106849276-106849298 TGCTCACTGCTGAAAAATTGAGG - Intergenic
1124230130 15:27937546-27937568 TACTGAGTGCTGAAAGATTGTGG - Intronic
1125845859 15:42852929-42852951 TACTGGGACCTGAAAGATTAGGG - Intronic
1126181768 15:45792481-45792503 TACCGAGTTATGAAAGAGTGAGG + Intergenic
1128618144 15:69126396-69126418 TACTGAGAGCTGAGATATTGAGG + Intergenic
1130399844 15:83540453-83540475 TACTAAGTGCTTAAAGATTTAGG + Intronic
1131102434 15:89703475-89703497 TGCTGAGTGCTGGAAGGGTGTGG - Intronic
1131676120 15:94672475-94672497 TACTGAGATCTGTAAGATTGTGG + Intergenic
1131956782 15:97744726-97744748 TACTGAGTGCTTCAATATTCTGG + Intergenic
1134374492 16:13659124-13659146 TACTATGAGCTGAAAGTTTGTGG - Intergenic
1135708731 16:24697094-24697116 CACTGAGGCCTGAAAGTTTGAGG + Intergenic
1138776229 16:59727264-59727286 TATTGAGTACTTTAAGATTGTGG + Intronic
1139499398 16:67349596-67349618 TACTTAGATCTGAATGATTGAGG - Intronic
1141487403 16:84349870-84349892 AACTGAGTTCAGAAAGATTGGGG + Intergenic
1142403906 16:89875422-89875444 TTCTGCGTGCTGAAAGATACTGG + Intronic
1143003453 17:3810851-3810873 TGCTGAGTGCTGAAAGGCCGTGG + Intergenic
1151998957 17:77632682-77632704 TTCTGAAGGCTGAAAGTTTGAGG - Intergenic
1152235414 17:79135882-79135904 TGCTGAGAGCTGAGAGCTTGTGG + Intronic
1153379480 18:4421316-4421338 TCCTTAGAGTTGAAAGATTGAGG - Intronic
1155280887 18:24238478-24238500 TACTCAGTGCTAAAAAAATGGGG - Intronic
1155595174 18:27477590-27477612 TAATGAATGCTGAAAAATAGAGG + Intergenic
1156257810 18:35414587-35414609 CATTGAGAGATGAAAGATTGAGG + Intergenic
1156649850 18:39212853-39212875 TCTTTAGTGCTGAAAGATTTGGG + Intergenic
1156797342 18:41062678-41062700 TAATGACTTCTGAAAGCTTGTGG + Intergenic
1159085423 18:63784173-63784195 TACTGTGTGCTGGTAGATGGCGG + Intronic
1163254849 19:16149501-16149523 TACTGTGTTCAGAAAGATTCTGG - Intronic
1167851495 19:52205854-52205876 AACTGAGTGCTGACAGCCTGAGG + Intronic
927107119 2:19837308-19837330 GACTGAGAGCTGAAAGAGCGTGG - Intergenic
927571833 2:24166940-24166962 TAGTGAGTGCTGAGAGAGGGCGG + Intronic
930139025 2:47933072-47933094 GGCTGAGAGCTGAAAGTTTGTGG + Intergenic
932561039 2:72869486-72869508 TACTGACAGCTGAAAGTGTGAGG + Intergenic
933382805 2:81571042-81571064 TACTGAGTGCAGACAAAATGTGG - Intergenic
935733735 2:106089462-106089484 TTCTGAGTGCTGTAAGACTCTGG + Intergenic
939153067 2:138495540-138495562 GACTGAGTGCTGAGAGATGCAGG + Intergenic
939322966 2:140648487-140648509 TACTGAGTTGTGAAATACTGTGG + Intronic
940286871 2:152041136-152041158 TACTGAGTGCCAAAAGTTTGTGG - Intronic
943376185 2:187079559-187079581 TGCTGGGTGCTGATAGAATGAGG + Intergenic
943462134 2:188182190-188182212 TGTTGAGTGCTCAATGATTGAGG + Intergenic
946222357 2:218239034-218239056 TACTGAGAGCTGACAGATGGTGG + Intronic
947104691 2:226656436-226656458 TTCTGAGTACTTAAAGACTGGGG - Intergenic
948023723 2:234758815-234758837 TCATTATTGCTGAAAGATTGAGG - Intergenic
1169879448 20:10330586-10330608 TACTGCGTGTTGAAAGATACGGG + Intergenic
1170516169 20:17132685-17132707 TACTGAGATGAGAAAGATTGAGG - Intergenic
1172430164 20:34883891-34883913 CTCTGAGTGCTCATAGATTGTGG - Intronic
1173103833 20:40112628-40112650 AACTGAGTGGTCATAGATTGGGG - Intergenic
1173696509 20:45019975-45019997 AACTAAGTGCAGAAAGAGTGGGG - Intronic
1176365574 21:6030637-6030659 TACTCAGTGCTGGAAGCCTGGGG - Intergenic
1179757944 21:43507908-43507930 TACTCAGTGCTGGAAGCCTGGGG + Intergenic
1183997756 22:41648323-41648345 TACTGAGTGATGAAGGGGTGAGG - Intronic
1184022389 22:41829579-41829601 AACTGAATCCTGAAAGATTAGGG + Intergenic
950445809 3:13037156-13037178 TATTGAGTGTAGAAAGAATGTGG + Intronic
950929097 3:16771288-16771310 TACTGAGGGCATAAAGATTGTGG - Intergenic
951521574 3:23615506-23615528 CACTGAGCTCTGAAAGATTTGGG - Intergenic
952882211 3:37991874-37991896 GAATGGGTGCTCAAAGATTGGGG - Intronic
955280522 3:57590184-57590206 TAATTAGTGATGAAAAATTGAGG + Intronic
955283882 3:57619921-57619943 TAATTAGTGATGAAAAATTGAGG + Intergenic
957614555 3:82509949-82509971 TACTGAGTCCGGGAAGAATGAGG - Intergenic
958710837 3:97715204-97715226 TAATGAGAGCTGAGAAATTGTGG + Intronic
959368257 3:105490879-105490901 TTCTGAGGGCTGCAAGATGGTGG + Intronic
959412648 3:106044693-106044715 TACTGTGTGCTGAATGAATGAGG + Intergenic
962121271 3:132562584-132562606 TACTAAGTGCTGATGGTTTGAGG - Intronic
968634836 4:1672470-1672492 TAGTGAGTGCAGAGAGAATGAGG + Intronic
972348505 4:38213563-38213585 TTCTGACTGCTGAAATACTGGGG - Intergenic
973177335 4:47224035-47224057 TACTGACAGCTGAATTATTGTGG + Intronic
975820694 4:78267632-78267654 TACTGAGAGCTAAAAGATCCAGG - Intronic
979227684 4:118307797-118307819 TCCTAAGTGCAGAAAGGTTGTGG - Intronic
980970422 4:139562114-139562136 TACAGTGTTCTGAAAGAATGAGG + Intronic
982555212 4:156852895-156852917 AACTCAGTTCTGAAAGATTGAGG + Intronic
982750816 4:159159069-159159091 TACTTATTGCTGTAAGATTCTGG - Intronic
985210485 4:187587182-187587204 CACAGAGAGCTGAAAGACTGGGG - Intergenic
986342210 5:6800421-6800443 TCCTGAGTTCTGAATGATTGTGG + Intergenic
986828898 5:11552654-11552676 CAGTGAGTGCTAGAAGATTGTGG - Intronic
987864522 5:23522705-23522727 GACTGAGGGCTGAACGGTTGGGG - Exonic
988325467 5:29760798-29760820 AACTGTGGACTGAAAGATTGAGG - Intergenic
989973986 5:50560061-50560083 TACTGAGTGATCAAATATTGGGG - Intergenic
991303443 5:65151092-65151114 AACTCAGTGCTGAAAGACTGTGG - Exonic
991392453 5:66161353-66161375 CACAGAGTGGTGAAAAATTGGGG + Intronic
991479053 5:67057312-67057334 TAATAAGTGCTGAGAGATGGAGG - Intronic
994596155 5:101838473-101838495 TACTTAGTGCTGGAAGAATGTGG - Intergenic
995048201 5:107672608-107672630 TACTGTTTGCTTACAGATTGGGG + Intergenic
997334497 5:133096682-133096704 TACTGAGTGATGCAAGGTTTGGG + Intronic
998267379 5:140676449-140676471 GATTGAGTGCAGAAAGATTATGG + Intronic
999834612 5:155355657-155355679 TACTCAGTGGTGCAAGAGTGTGG - Intergenic
1004665792 6:17747458-17747480 TAGTGACTGCTGAAATATGGGGG - Intergenic
1004995369 6:21186134-21186156 TGCCCACTGCTGAAAGATTGTGG + Intronic
1005347971 6:24909192-24909214 TCCTGAGTGCTGGGAGATGGGGG + Intronic
1007150618 6:39687190-39687212 TACTGAGTGGTGAAAGTAGGGGG + Intronic
1008336379 6:50309533-50309555 TTCTGAGTGCTTAAACATTAAGG - Intergenic
1009697445 6:67125621-67125643 TTCTGTGTGCTGTAGGATTGAGG + Intergenic
1013734257 6:113207164-113207186 TAGTGAGTGATGAAAGATTTAGG - Intergenic
1014076606 6:117242580-117242602 TAGTGATTGATGAAAGTTTGGGG - Intergenic
1014615387 6:123591605-123591627 TACTCAGTCCAGAAAGATAGAGG - Intronic
1014756958 6:125311790-125311812 TACTGAGTGCTGATGAATTTGGG - Intergenic
1017157659 6:151336768-151336790 TTCTGACTGGTGCAAGATTGTGG + Intronic
1021628389 7:22617743-22617765 TTCTCAGTTCTGAAAGATTGTGG - Intronic
1022055932 7:26734458-26734480 TTCTGAGTTGTGAAAGACTGTGG - Intronic
1026011879 7:66642805-66642827 TACTGAGTGGGGAAGGATGGGGG + Exonic
1028908599 7:96182624-96182646 TACTGAGTGCTGAGCTAATGTGG - Intronic
1031233257 7:119138004-119138026 TACTGACTACTGAAACTTTGTGG - Intergenic
1034217713 7:149421079-149421101 TAGTGGGTCCTGAAAGATTTTGG + Intergenic
1035543290 8:458934-458956 TACCGAGTGCTGAGAGACTGAGG - Intronic
1036006780 8:4673884-4673906 TAATGATTGCTGAAAGATACAGG + Intronic
1037377778 8:18250605-18250627 TACTGAGTTCTGGGATATTGAGG - Intergenic
1038112826 8:24518399-24518421 TACTGTGAGATGAAACATTGAGG - Intronic
1038877302 8:31566087-31566109 TACTCACTGTTGAAAGATTGGGG + Intergenic
1040935621 8:52778768-52778790 TACTGAGGGTTGAAAGCTAGGGG + Intergenic
1042055572 8:64761828-64761850 TATGGAGTGCTGAAATTTTGGGG - Intronic
1042744961 8:72097691-72097713 TATTGAGGGCATAAAGATTGAGG + Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1047281443 8:123449642-123449664 TACTGAGTTGGGGAAGATTGTGG + Intronic
1048895740 8:138990680-138990702 TTCTGAGGTCTGAAAGATGGTGG + Intergenic
1050789453 9:9447906-9447928 GACTGAGTGATGAAAGATCAAGG + Intronic
1051053445 9:12956419-12956441 AACTGAGTGCTAAAAGTGTGAGG - Intergenic
1051166325 9:14266050-14266072 TCCTGAGGGCTGAAAGATGTGGG + Intronic
1051919015 9:22241955-22241977 TACTGAGTGCTAATAAAATGTGG - Intergenic
1051955326 9:22686369-22686391 TACTGAGTACTAAAGGATAGTGG + Intergenic
1052151089 9:25116425-25116447 TCTTGAGTGCTGAGAGAATGAGG - Intergenic
1053118464 9:35526259-35526281 TACTGAGTTCTGGAAGATGCTGG + Intronic
1053559805 9:39179497-39179519 GACAGAGTGCTGAGAGAGTGTGG - Intronic
1053823916 9:41999725-41999747 GACAGAGTGCTGAGAGAGTGTGG - Intronic
1054137311 9:61439458-61439480 GACAGAGTGCTGAGAGAGTGTGG + Intergenic
1054606656 9:67187638-67187660 GACAGAGTGCTGAGAGAGTGTGG + Intergenic
1054718166 9:68578109-68578131 TTCTGTGTGCTAAAAGTTTGAGG - Intergenic
1058414327 9:104770081-104770103 TACTTAGTGCTGAAAGTTAAGGG - Intronic
1060983944 9:127809290-127809312 TGCTGGGTGCTGAAAGCTTTGGG - Intronic
1062197781 9:135284007-135284029 AGCTGAGTGCTGCAAGAGTGTGG - Intergenic
1186006697 X:5080133-5080155 TAGTGAGTGCTGTATGTTTGTGG + Intergenic
1186485323 X:9930214-9930236 TATTGAACGCTGAAATATTGAGG + Intronic
1189074223 X:37898932-37898954 TGCTGGGTCCTGAAAGAATGTGG - Intronic
1189470650 X:41311378-41311400 CCCTGAGTGGTGAAAGATGGCGG + Intergenic
1192599965 X:72451823-72451845 TACTGATTCCTGAAAGACAGAGG + Intronic
1196468725 X:116000241-116000263 AACTGAGTGCTGAACAATTCAGG + Intergenic
1198010367 X:132546375-132546397 TACTGTGAGCAGAAAGATAGAGG - Intergenic
1198510145 X:137342209-137342231 AGCTGATTGCTGATAGATTGGGG + Intergenic
1200112530 X:153749056-153749078 CACTGAGAGCTGAAACATCGGGG + Intergenic
1201065285 Y:10090405-10090427 TACTGAGTGCTGTAGGCTTTTGG - Intergenic