ID: 1124232556

View in Genome Browser
Species Human (GRCh38)
Location 15:27957805-27957827
Sequence CTGTCAGGCATCGACTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124232556_1124232560 13 Left 1124232556 15:27957805-27957827 CCCACACAGTCGATGCCTGACAG 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1124232560 15:27957841-27957863 TCGAGACGTGCAGGTAGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 49
1124232556_1124232561 14 Left 1124232556 15:27957805-27957827 CCCACACAGTCGATGCCTGACAG 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1124232561 15:27957842-27957864 CGAGACGTGCAGGTAGCCCAGGG 0: 1
1: 0
2: 0
3: 2
4: 64
1124232556_1124232559 4 Left 1124232556 15:27957805-27957827 CCCACACAGTCGATGCCTGACAG 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1124232559 15:27957832-27957854 GACACACACTCGAGACGTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124232556 Original CRISPR CTGTCAGGCATCGACTGTGT GGG (reversed) Intronic
905824470 1:41018056-41018078 CTATCAGGCAGCGTGTGTGTAGG + Exonic
906104284 1:43282742-43282764 CTGTCAGGCATGGAGGGAGTGGG + Exonic
907263073 1:53236748-53236770 CTGACAGGCCTCGACTGTGAGGG - Intronic
916215552 1:162390217-162390239 TCATCAGTCATCGACTGTGTAGG + Intergenic
917941560 1:179927479-179927501 CTGTGTGGCATCAACTGTGATGG + Intergenic
920263278 1:204704025-204704047 CTGGCAGCCATCGACTGCATCGG + Intergenic
923714131 1:236410621-236410643 CTGTCAGGCAGCGTGTGTGATGG + Intronic
1063513140 10:6666592-6666614 ATGTCAGGTATCTACTTTGTTGG - Intergenic
1067164315 10:43853008-43853030 CTGTGATGCATCCACTCTGTTGG - Intergenic
1077341400 11:2027948-2027970 CTCTCAGGCACCGGCCGTGTGGG + Intergenic
1078441266 11:11370861-11370883 CTGTCAGGAATTGTCTGAGTGGG - Intronic
1081081392 11:38744090-38744112 CTGTCAGGCACCTACGGTGAGGG - Intergenic
1202824385 11_KI270721v1_random:83137-83159 CTCTCAGGCACCGGCCGTGTGGG + Intergenic
1100877081 12:98973975-98973997 GTTTCAGGCATCCACTGGGTGGG + Intronic
1112508758 13:99990793-99990815 CTGCCAGGCAGAGAGTGTGTGGG + Intergenic
1112693498 13:101920685-101920707 TTGTCATGCATCCACTGTGGGGG - Intronic
1116940233 14:50783862-50783884 CTGCCAGGCTTCCACTGTGCTGG - Intronic
1117771792 14:59140955-59140977 CTATGAGGCATCCACTGTTTTGG - Intergenic
1120332212 14:83107944-83107966 CTGTCTGGCATCAGCTGTGATGG - Intergenic
1124139380 15:27063955-27063977 CAGTAAGGGATGGACTGTGTGGG - Intronic
1124232556 15:27957805-27957827 CTGTCAGGCATCGACTGTGTGGG - Intronic
1126364832 15:47883426-47883448 CTGTCAGGAATTGACCCTGTGGG - Intergenic
1141118217 16:81329943-81329965 CTGTCCTCCATTGACTGTGTGGG + Intronic
1150709011 17:67514104-67514126 CTGTGAGGGAGAGACTGTGTGGG + Intronic
1152015353 17:77746999-77747021 CATTCAGGCATCGGCTGTCTGGG + Intergenic
1154039003 18:10835111-10835133 TTGCCAGGCACCGACTCTGTTGG + Intronic
1154969149 18:21389826-21389848 CTGCCAGCCATTGACTGTGTCGG - Intronic
1160782076 19:882123-882145 CTGTCAGGCAGCGGATCTGTGGG - Intronic
927756296 2:25710977-25710999 CTCTCAGTGATCGAATGTGTTGG - Intergenic
929822091 2:45281902-45281924 CTGTCAGGCCACGACTGTTGTGG - Intergenic
929930342 2:46250778-46250800 GTGTCAGGCAATAACTGTGTGGG + Intergenic
930579163 2:53189047-53189069 CTGTCAGGCATACACTGTTCTGG - Intergenic
933507524 2:83197601-83197623 CTGTCAGGCATAGAATTGGTTGG + Intergenic
933890150 2:86760613-86760635 CTCTCAGGCAACAGCTGTGTGGG + Intronic
938247085 2:129786111-129786133 CTATCAAGCATCTACTGTGCCGG + Intergenic
938291814 2:130154626-130154648 ATGTCAGCCACCTACTGTGTGGG - Intronic
938464734 2:131518338-131518360 ATGTCAGCCACCTACTGTGTGGG + Intergenic
945897880 2:215504931-215504953 AAGACAGGCATCGTCTGTGTTGG + Intergenic
1170546175 20:17437223-17437245 CTGCCAGCCAACGACTGAGTGGG - Intronic
1171519295 20:25763880-25763902 GTCTCAGGCAGCAACTGTGTTGG + Intronic
1171557633 20:26092611-26092633 GTCTCAGGCAGCAACTGTGTTGG - Intergenic
1172175413 20:32969338-32969360 TTGTTAAGCATCTACTGTGTGGG + Intergenic
1172788245 20:37484629-37484651 CTGCCAGTCATGCACTGTGTTGG + Intergenic
1177616703 21:23531938-23531960 TTGTCAGGCATCTATTTTGTTGG - Intergenic
1181570334 22:23764807-23764829 CTGTCAGGCCTCTCCTCTGTGGG + Exonic
1182422988 22:30257575-30257597 GTGTCAGGCACAGACTGGGTGGG - Intergenic
950691123 3:14658791-14658813 CTGTCAGGCAGGGAGTGTGGGGG + Intronic
955936766 3:64109665-64109687 CAGTCAGGCATGGGCTGTTTAGG + Intronic
956615631 3:71169188-71169210 CTGACAGGCGTCCACTGTGATGG - Intronic
960996935 3:123346362-123346384 CTGTCAGGTAGGGACAGTGTAGG - Intronic
961512648 3:127412644-127412666 CTGTCAGGCCTCGTCTCTGAAGG - Intergenic
962319132 3:134376532-134376554 CTGTCAGGCATGGCCTGCGGTGG + Intergenic
964449209 3:156794244-156794266 CTATCAGCCTTAGACTGTGTAGG - Intergenic
969321392 4:6415095-6415117 CTGTGAGGCAGCGGCTCTGTGGG - Intronic
975929076 4:79495795-79495817 ATGTCAGGCATGTTCTGTGTTGG + Intergenic
985571593 5:648887-648909 CTGTGAGGCGTGGACTGTGAGGG + Intronic
985571655 5:649413-649435 CTGTGAGGCGTGGACTGTGAGGG + Intronic
985571688 5:649693-649715 CTGTGAGGCGTGGACTGTGAGGG + Intronic
985571805 5:650723-650745 CTGTGAGGCGTGGACTGTGAGGG + Intronic
995454305 5:112335615-112335637 CTATCAGGCAATGACTGTGGAGG - Intronic
1001272522 5:170325751-170325773 CCTTCAGGCAGCGAGTGTGTGGG + Intergenic
1007026058 6:38575877-38575899 CTGTCTGGCCTTGACTTTGTTGG - Intronic
1018956544 6:168413955-168413977 CTGGCAGGGATCGGCTGTGCAGG + Intergenic
1020117109 7:5482050-5482072 CTGGCAGGCATGGTCTGTCTGGG - Intronic
1030086832 7:105823225-105823247 ATGTCAGCCTTCGACTTTGTAGG - Intronic
1033342510 7:140502988-140503010 CTGTCACGCATGGAGTGTATTGG - Intergenic
1040870674 8:52097642-52097664 CTGCTAGGCATCAACTGTCTTGG + Intergenic
1045837026 8:106534640-106534662 CTATCAGTCATTGGCTGTGTTGG + Intronic
1046695339 8:117333449-117333471 CTGTCAGACATCAGCTCTGTAGG + Intergenic
1047353770 8:124100650-124100672 CTGTCAGGCATGCACTGGGCTGG - Intronic
1051398589 9:16654954-16654976 CTGTCAGGCATTGATTGACTAGG - Intronic
1056308297 9:85313162-85313184 CTCCCAGGCATCGCCTCTGTTGG + Intergenic
1056714934 9:89021062-89021084 CTGGCGGGCATCTCCTGTGTGGG - Intronic
1058109515 9:101017059-101017081 CTGCCAGTCATGGACAGTGTGGG + Intergenic
1059723872 9:116987081-116987103 GTGTCAGGCATCCACTGGGTGGG - Intronic
1188797246 X:34481818-34481840 CTGTCAGACCTCAACTCTGTAGG - Intergenic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic