ID: 1124232743

View in Genome Browser
Species Human (GRCh38)
Location 15:27959634-27959656
Sequence GAGACTTCCAGCCCGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124232743_1124232751 29 Left 1124232743 15:27959634-27959656 CCTGGGTGCGGGCTGGAAGTCTC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1124232751 15:27959686-27959708 CCTGGGAACCAAGGCTATGCTGG 0: 1
1: 0
2: 1
3: 15
4: 165
1124232743_1124232748 12 Left 1124232743 15:27959634-27959656 CCTGGGTGCGGGCTGGAAGTCTC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1124232748 15:27959669-27959691 TGTTTGGAGAAGCAAAGCCTGGG 0: 1
1: 0
2: 6
3: 20
4: 230
1124232743_1124232749 20 Left 1124232743 15:27959634-27959656 CCTGGGTGCGGGCTGGAAGTCTC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1124232749 15:27959677-27959699 GAAGCAAAGCCTGGGAACCAAGG 0: 1
1: 0
2: 1
3: 27
4: 355
1124232743_1124232747 11 Left 1124232743 15:27959634-27959656 CCTGGGTGCGGGCTGGAAGTCTC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1124232747 15:27959668-27959690 ATGTTTGGAGAAGCAAAGCCTGG 0: 1
1: 0
2: 0
3: 19
4: 253
1124232743_1124232744 -4 Left 1124232743 15:27959634-27959656 CCTGGGTGCGGGCTGGAAGTCTC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1124232744 15:27959653-27959675 TCTCTCCATGCCTTTATGTTTGG 0: 1
1: 1
2: 2
3: 22
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124232743 Original CRISPR GAGACTTCCAGCCCGCACCC AGG (reversed) Intronic
900167754 1:1250642-1250664 GTGACTTGCTGCCCTCACCCTGG + Intergenic
900865315 1:5264864-5264886 GAGACTTCCAGGCAGTAACCAGG - Intergenic
901090445 1:6637399-6637421 GAGACCCCCAGCGCCCACCCTGG + Intronic
902567659 1:17323145-17323167 GAGGCTTCCAGCCAACAGCCAGG - Intronic
902791618 1:18772493-18772515 GAGCCTTTCTGCCAGCACCCAGG + Intergenic
903027813 1:20442102-20442124 GAGACTTCTAGAGCTCACCCCGG - Intergenic
904310131 1:29623785-29623807 CTGACTTCCAGGCAGCACCCAGG - Intergenic
904750261 1:32737431-32737453 GAAACTTCCAGCCTGTCCCCAGG - Intergenic
904852168 1:33467459-33467481 GAGCCAGCCAGCCCTCACCCAGG - Intergenic
905309274 1:37038141-37038163 AAGACTCCCAGCCCCCTCCCTGG + Intergenic
905459322 1:38112026-38112048 GAGACTTCCAGGCCAGAGCCTGG + Intergenic
905461182 1:38123958-38123980 GAGGGTCCCAGCCCGCACGCGGG + Intergenic
906797263 1:48708190-48708212 GGATCTTCCAGCCCACACCCAGG + Intronic
908970420 1:69822173-69822195 GAGACTCCCAGCACACAGCCTGG - Intronic
920032618 1:203046361-203046383 GAGAATTGCAGCCCTCACCAAGG + Intronic
922828136 1:228535827-228535849 GAGACATCTAGCCCACCCCCAGG - Intergenic
924641517 1:245837724-245837746 GAGACTTCTAGTCCACCCCCGGG + Intronic
1066058389 10:31701763-31701785 GAGACTCCCAGACAGCACTCCGG + Intergenic
1076181747 10:128414718-128414740 GAGGCTAACAGCCCACACCCAGG - Intergenic
1077182022 11:1221010-1221032 GAGACCCCCTGCCCCCACCCAGG + Intergenic
1077918110 11:6624068-6624090 GAGTCTTCCAGCTGGAACCCAGG - Exonic
1081679302 11:44990464-44990486 CAGACTCCCAGGCCCCACCCTGG + Intergenic
1083200989 11:61121008-61121030 CAGACTCCCAGGCCCCACCCTGG + Intronic
1084962115 11:72722380-72722402 GACACTTCCTCCCCGCCCCCAGG + Intronic
1089645651 11:119876790-119876812 GAAACTGCCACCCCGCAGCCTGG - Intergenic
1091355223 11:134932758-134932780 GAGCCTTCCAGCCTGAAACCTGG + Intergenic
1092091030 12:5803783-5803805 GAGACTTCCAGCCCCTACCTGGG + Intronic
1094690249 12:32761510-32761532 GAGACCTCCAGCTGGCACTCAGG - Intergenic
1096978791 12:55716604-55716626 GAGATTTCCAGCCCGGACTCAGG - Intronic
1099520136 12:83650225-83650247 GAGAATTCCAACCAACACCCAGG + Intergenic
1101874452 12:108589372-108589394 GCGACTTCTCCCCCGCACCCTGG - Intergenic
1102490719 12:113288234-113288256 GGTACTGCCAGCCCCCACCCTGG + Exonic
1104469645 12:129019196-129019218 GAGACTTTCTGCCCACAGCCAGG + Intergenic
1107449871 13:40498598-40498620 GCAACTTCCTGCCCGCAGCCTGG + Intergenic
1110560252 13:76903773-76903795 AAGACTTCCAGTCAGCTCCCTGG - Intergenic
1110860916 13:80343245-80343267 GAGACTTGCTGGCCGCACACCGG - Intergenic
1113725052 13:112592432-112592454 GAGAGTGCCAGCCCCCACCCTGG + Intergenic
1123987823 15:25660232-25660254 GAGGCATCCAGTCTGCACCCTGG - Intergenic
1124232743 15:27959634-27959656 GAGACTTCCAGCCCGCACCCAGG - Intronic
1125529597 15:40404161-40404183 GAGACTGCCCACCCCCACCCCGG + Intergenic
1126900251 15:53307524-53307546 GAGAGTTCCAGCCCCACCCCAGG - Intergenic
1126913291 15:53437398-53437420 GATGCTTCCAGCCCCCAGCCTGG - Intergenic
1130938769 15:88490897-88490919 CAGACTTTCAGGCCGCACCCAGG - Intergenic
1131949826 15:97669860-97669882 GAGACTTCTAGCCAACAACCTGG + Intergenic
1132675877 16:1121055-1121077 GAGAATTCCAGCCCACAAGCCGG - Intergenic
1133339355 16:5026865-5026887 GAAACCTCCTGCCCCCACCCTGG + Intronic
1133355700 16:5135088-5135110 AAGACTTCCAGGGCTCACCCGGG + Intergenic
1136058363 16:27707446-27707468 GACACTTACAGAGCGCACCCAGG + Intronic
1137926300 16:52545933-52545955 GAGACCTCCACACCACACCCTGG - Intronic
1138029211 16:53546460-53546482 CAGACTTCCAGCCTAAACCCTGG - Intergenic
1138444685 16:57055885-57055907 GAGACTGCAAGACCCCACCCTGG - Intronic
1139848496 16:69936677-69936699 GAGACTTCAAGCCTGCAGCGTGG + Intronic
1141820345 16:86441490-86441512 GAGAATTCCAGGACGCACCCGGG - Intergenic
1141835546 16:86536625-86536647 GTGACTTCCAGACCCCTCCCAGG - Intronic
1142106485 16:88306349-88306371 GAGAGCTCCAGCCCTCACACAGG - Intergenic
1142805808 17:2370551-2370573 GTGACTTCCATCCAGCTCCCTGG + Intronic
1143378515 17:6481054-6481076 GAGACTTCCAACTCGCAGCAGGG - Intronic
1148714682 17:49707698-49707720 GAGACTGTCGGCCCGCCCCCGGG + Intronic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1153973313 18:10245992-10246014 GACTCTTCCAGGCCCCACCCAGG - Intergenic
1154252927 18:12759004-12759026 GAGACCTCCAGCCTTCACCAGGG - Intergenic
1155025289 18:21935284-21935306 GAGGCTTCCAGACATCACCCAGG - Intergenic
1158307648 18:56124662-56124684 GAGACTTTGAGCCCTTACCCAGG + Intergenic
1159032271 18:63243603-63243625 AAGAGTTTCAGCCCTCACCCTGG - Intronic
1160196230 18:76758030-76758052 GAGACTTCCAGCACGGACAGCGG - Intergenic
1160738148 19:674147-674169 AGGACTTCCAGCCCGCAGCCTGG - Intergenic
1161069599 19:2253517-2253539 GAGGCTCCCAGACCCCACCCTGG + Intronic
1161407703 19:4099602-4099624 GAGGCTTCCAGCCCGAGGCCTGG + Intronic
1161620376 19:5293989-5294011 GAGTTTTCAAACCCGCACCCCGG - Intronic
1163148232 19:15396710-15396732 GAGACTTCAGGCCTGCACCTGGG - Intronic
1165155935 19:33787608-33787630 AAGAATTCCAGACCGAACCCGGG + Intergenic
1165473720 19:36017625-36017647 CAAACTTCCAGCCCAAACCCAGG - Intronic
1165760961 19:38320931-38320953 GAGACCTCCAGCAAGGACCCAGG + Intronic
1165977066 19:39685430-39685452 GAGACAACCAGCCAGCCCCCAGG - Intergenic
1166746650 19:45145014-45145036 GAGCCCACCAGCCCGCACCCTGG - Intronic
1167446973 19:49543445-49543467 GAGTCTCCCAGCCCAGACCCAGG + Exonic
1167594888 19:50422406-50422428 GGGACTCCCAACCCCCACCCTGG - Intronic
925385869 2:3461328-3461350 AAGACGTGCAGCCCGCACCCCGG + Intronic
926692652 2:15748045-15748067 GCGCCCCCCAGCCCGCACCCTGG - Intergenic
929057464 2:37890929-37890951 CAGACTGCCAGCCCCTACCCAGG + Intergenic
932832036 2:74999510-74999532 AAAACTTCCAGATCGCACCCAGG + Intergenic
934983852 2:98869917-98869939 GGGATTTCCAGCCCTCCCCCTGG + Intronic
937368903 2:121284666-121284688 GAAACTTCCTGCCAGCAGCCTGG - Intronic
940329119 2:152455422-152455444 GAAAGTTCCAGCCAGCACACAGG + Intronic
943461461 2:188174352-188174374 GAGTCATCCCGCCTGCACCCAGG - Intergenic
945443960 2:209913875-209913897 GAGACATCCAGCCAGCTGCCTGG + Exonic
946431996 2:219631061-219631083 GCGGCATCCAGCCCCCACCCTGG - Intronic
947516682 2:230811554-230811576 GAGACTTGCAGCCAGAATCCAGG - Intronic
948316291 2:237030683-237030705 GAGAAGGCCAGCCCTCACCCTGG + Intergenic
948316309 2:237030742-237030764 GAGAAGGCCAGCCCACACCCTGG + Intergenic
948316327 2:237030801-237030823 GAGAAGGCCAGCCCACACCCTGG + Intergenic
948316345 2:237030860-237030882 GAGAAGGCCAGCCCACACCCTGG + Intergenic
948316363 2:237030919-237030941 GAGAAGGCCAGCCCACACCCTGG + Intergenic
948316381 2:237030978-237031000 GAGAAGGCCAGCCCACACCCTGG + Intergenic
948316399 2:237031037-237031059 GAGAAGGCCAGCCCACACCCTGG + Intergenic
948316409 2:237031067-237031089 GAGAAGGCCAGCCCACACCCTGG + Intergenic
948316427 2:237031126-237031148 GAGAAGGCCAGCCCACACCCTGG + Intergenic
948316474 2:237031308-237031330 GAGAAGGCCAGCCCTCACCCTGG + Intergenic
948536408 2:238650665-238650687 GAAACTCCCAGCCCCCTCCCAGG + Intergenic
1169332441 20:4726902-4726924 GAGACGTCCACCCTGCAGCCAGG + Exonic
1175400415 20:58697004-58697026 GAACCTTCCAGTCCCCACCCAGG + Intronic
1176037747 20:63048633-63048655 GAGGCCTCCACCCAGCACCCAGG - Intergenic
1176267410 20:64217411-64217433 GAGACCTCCAGCCTGCATCGTGG - Intronic
1181967940 22:26669687-26669709 CAGAATTCCCGCCCCCACCCAGG + Intergenic
1182443927 22:30379547-30379569 GACCCTTCCTGCCTGCACCCCGG - Exonic
1183029519 22:35093034-35093056 GATACTTCCAGCTCACTCCCTGG - Intergenic
1183936573 22:41265791-41265813 GAGACTTTCTGCCCTCACCCTGG + Intronic
953948395 3:47167897-47167919 GCAACTTCCACCCCCCACCCCGG - Intergenic
955126047 3:56113970-56113992 GAGAGTTGCAGCCTGCAGCCTGG + Intronic
964074413 3:152675925-152675947 AAGGCTTCCAGCCAGCCCCCAGG - Intergenic
967048468 3:185759686-185759708 GTGACTTAGAGCCAGCACCCAGG + Intronic
968009810 3:195266770-195266792 CAGACTTCCAGGCCCCACCCAGG + Intronic
968594093 4:1473464-1473486 GGGACCTCCAGCCCTGACCCAGG + Intergenic
968649343 4:1754236-1754258 GAGCCTACCACCCGGCACCCGGG + Intergenic
969990231 4:11254525-11254547 CAAACTGCCAGCCCGCACTCTGG - Intergenic
975870698 4:78776142-78776164 GAGACGTCTAGCCCACTCCCTGG + Intergenic
979487397 4:121284152-121284174 GAGAATTCCAGACCCCACCATGG + Intergenic
984732469 4:183080552-183080574 GAGTCTTCCAGCTTGCACCTTGG + Intergenic
986441849 5:7789852-7789874 GAAGCTTTCAGCCCTCACCCAGG - Intronic
992530840 5:77650425-77650447 GTGACTTCCTGCTGGCACCCAGG + Intergenic
992654986 5:78900274-78900296 GAGACTACCATCCCCAACCCTGG - Intronic
996190172 5:120530791-120530813 GAGACTGCCTGCCATCACCCAGG + Intronic
1002200630 5:177525821-177525843 GAGCCTTCCAGGCCTCACCTGGG - Intronic
1006642958 6:35497800-35497822 GAGACTTCCAGCTCGCGCCTCGG + Intergenic
1007075079 6:39061067-39061089 GAGGGTTCCAGGCAGCACCCTGG + Intronic
1010141471 6:72619918-72619940 GAGACTTCTTGCCTGCACGCGGG + Intergenic
1019758556 7:2791396-2791418 AAGATTTCCATCCCCCACCCCGG + Intronic
1020097383 7:5376595-5376617 GGGAATCCCAGCCCCCACCCAGG + Intronic
1020914383 7:14174146-14174168 GAGATTTCCAGCATGCACCGGGG + Intronic
1021986347 7:26101661-26101683 CAGACTTCCAGGCTGCACCCTGG - Intergenic
1023982099 7:45076241-45076263 GAGCCTTCCACCCCGCACTGAGG - Exonic
1024181268 7:46897536-46897558 GAGACCTCCAGCCTAGACCCAGG - Intergenic
1028035138 7:85972500-85972522 GAAACTGACAGCCCGCCCCCAGG + Intergenic
1029305569 7:99617146-99617168 GAGACTTGCCGCCCTCAGCCGGG - Intronic
1029569956 7:101362883-101362905 CACATTTCCAGCTCGCACCCGGG + Exonic
1030057261 7:105594272-105594294 AAGACTTCTAGTCTGCACCCAGG - Intronic
1031851643 7:126872015-126872037 GATATTGCCAGCCCACACCCAGG + Intronic
1032185288 7:129719887-129719909 GAGACTTGCAGCCAACACCTTGG + Intronic
1034468769 7:151245043-151245065 GAGCCTTCCTGCCGGCCCCCGGG - Intronic
1039745475 8:40422216-40422238 GAAACTTCCAGCACCCAGCCTGG + Intergenic
1040605952 8:48931447-48931469 GAGACCCCAAGCCCCCACCCAGG - Intergenic
1043463685 8:80485983-80486005 GAGACCCCCAGCCCGCCGCCCGG + Intronic
1044901407 8:96949456-96949478 AAGACTTCCAGTCCAGACCCAGG + Intronic
1047724790 8:127674618-127674640 GAGGCCTCCAGCCAGCAGCCAGG - Intergenic
1049346370 8:142141279-142141301 GAGCCTTGCAGCCTGCTCCCTGG + Intergenic
1054888030 9:70220355-70220377 GAGACTTCCAGCTCACAGTCTGG + Intronic
1055856803 9:80698169-80698191 GAGAATTCCAGCCAGCACTAAGG - Intergenic
1056726289 9:89121575-89121597 GAAACTTCCAGCCAGCACAGTGG - Intronic
1057488697 9:95506283-95506305 GAAACCCCCTGCCCGCACCCGGG - Intronic
1058147791 9:101430857-101430879 CCGATTTCCAGCCCTCACCCAGG - Exonic
1060204467 9:121674420-121674442 CAGTCTCCCAGCCCACACCCAGG - Intronic
1061890615 9:133617248-133617270 GACACATCCAGCCCTCACCACGG + Intergenic
1186951133 X:14626500-14626522 GAGGCTTCCAGTATGCACCCTGG + Intronic
1190055009 X:47176172-47176194 GACACTGCCAGGCCACACCCAGG - Intronic
1190730678 X:53223669-53223691 GAGACTTCTAGCCTGAAGCCAGG + Intronic
1200281533 X:154781138-154781160 GTGACCTCCAGCCAGCACTCTGG + Intronic