ID: 1124233631

View in Genome Browser
Species Human (GRCh38)
Location 15:27968044-27968066
Sequence CTGCTCTTTCGCTGACGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124233628_1124233631 10 Left 1124233628 15:27968011-27968033 CCTGGAATAAGTCAGCAGCGTCA 0: 4
1: 3
2: 0
3: 3
4: 85
Right 1124233631 15:27968044-27968066 CTGCTCTTTCGCTGACGTCCTGG 0: 1
1: 0
2: 2
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124233631 Original CRISPR CTGCTCTTTCGCTGACGTCC TGG Intronic
900242266 1:1622782-1622804 CTGCACTGTCCCTGACGTGCAGG + Intronic
900622134 1:3592336-3592358 CTGCTCCCTCTCTGACGTTCCGG + Intronic
903281340 1:22251684-22251706 GTGCTCTTTCCCTGACATCATGG - Intergenic
908694026 1:66816279-66816301 CTTCCCTTTCCCTCACGTCCCGG + Intronic
914884614 1:151574789-151574811 CTGCTCTTTGGCAGCTGTCCAGG + Intronic
915267911 1:154731935-154731957 CTGCTCTTTGGCCTTCGTCCTGG - Intronic
918543465 1:185656964-185656986 CTGGTCCTTGGCTGACATCCAGG - Intergenic
919780444 1:201217428-201217450 CTGGTCGTTCACTGCCGTCCAGG - Exonic
1071238529 10:83677988-83678010 CTGCACTTTCTCTGGTGTCCAGG - Intergenic
1072601779 10:96937975-96937997 CTGGTCTTGCCCTGTCGTCCAGG + Intronic
1075054456 10:119207356-119207378 CTTCGCTTTCGGTGCCGTCCCGG + Intergenic
1081988584 11:47325369-47325391 CTCCTCTTTCCCTGATGTCCGGG + Intronic
1090522985 11:127498591-127498613 CAGCTCTTTCCCTGACTACCTGG + Intergenic
1092976945 12:13754752-13754774 ATGCTCTTTCTCTGACCTACAGG + Intronic
1094176427 12:27546462-27546484 CTGCTTTTCCACTGACTTCCAGG + Intronic
1102970186 12:117160298-117160320 CTGCTCTGTCCCTGAATTCCAGG + Intronic
1117814982 14:59588151-59588173 CTGCTCTCTCCCTGTCGGCCTGG + Intergenic
1118404362 14:65409173-65409195 CTGCCCTTTGGATGACTTCCTGG + Intergenic
1123458948 15:20450655-20450677 CTGTTCTTTCCCTGAAGTTCTGG - Intergenic
1123659114 15:22549763-22549785 CTGTTCTTTCCCTGAAGTTCTGG + Intergenic
1124233618 15:27967891-27967913 CTGTTCTTTCACTGACGTCCTGG + Intronic
1124233622 15:27967942-27967964 CTGTTCTTTCACTGACGTCCTGG + Intronic
1124233627 15:27967993-27968015 CTGTTCTTTCACTGGCGTCCTGG + Intronic
1124233631 15:27968044-27968066 CTGCTCTTTCGCTGACGTCCTGG + Intronic
1124233635 15:27968095-27968117 CTGTTCTTTCACAGACGTCCTGG + Intronic
1124265186 15:28226493-28226515 CTGTTCTTTCCCTGAAGTTCTGG - Intronic
1124312978 15:28644255-28644277 CTGTTCTTTCCCTGAAGTTCTGG + Intergenic
1127430950 15:58907593-58907615 CTGGTCTTGCTCTGTCGTCCAGG - Intronic
1130021925 15:80239062-80239084 CTGCTCTGTCGCTGACTGCTCGG - Intergenic
1131009843 15:89008087-89008109 CTGCTCTTCCTCTGAAGTCCTGG + Intergenic
1134419588 16:14072676-14072698 CTGCTCTTTCCCTGAAGTAGCGG - Intronic
1141867510 16:86760891-86760913 CCGCTCATACGCTGAGGTCCAGG - Intergenic
1147306494 17:39567946-39567968 CATCTCTTTCCCTGAAGTCCAGG - Intergenic
1148977161 17:51539521-51539543 CTGCTCTCTCTTTGACGACCAGG + Intergenic
1150929122 17:69565273-69565295 CTGCCCAATTGCTGACGTCCTGG - Intergenic
1151202576 17:72479439-72479461 CTCCTCTTGAGCTGAGGTCCTGG + Intergenic
1152483161 17:80569938-80569960 CTGCTCTTTGCCTGGCCTCCTGG + Intronic
1152732222 17:81977905-81977927 CTGCGCTTCCGCTGGGGTCCCGG + Intronic
1153172156 18:2328553-2328575 CAGCTTTTTCGCTGAGGTTCTGG - Intergenic
1156702451 18:39841735-39841757 CTGTCCTTTCGCCGCCGTCCGGG + Intergenic
927990252 2:27442430-27442452 CTGCGCTTTCGGTAACTTCCGGG + Exonic
929493789 2:42421799-42421821 CTGCTCTTCTGCTGTGGTCCTGG - Intronic
931172172 2:59814921-59814943 CTGCTGGCTCGCTGAGGTCCTGG - Intergenic
935334592 2:102004844-102004866 CAGCTCTTTTGCTCAAGTCCAGG + Intronic
935587259 2:104812726-104812748 CTGCTCTGTAGCTGACATCAGGG - Intergenic
936013822 2:108942956-108942978 CGGCCCCTTCGCTGACGTGCAGG + Intronic
936291535 2:111228057-111228079 CTGCTCTCAGGCTGAAGTCCAGG + Intergenic
939139609 2:138338159-138338181 CTGCTCTTTCTCTAACATCTAGG - Intergenic
940158268 2:150682274-150682296 CTGCTTTTTCTTTGACTTCCAGG + Intergenic
942384170 2:175423865-175423887 CTGCTCTTGCCCTGTAGTCCTGG - Intergenic
942542656 2:177030885-177030907 CAGATCTTTCGCTGACGTGATGG + Intergenic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948128851 2:235585357-235585379 CTGCTCTGACCCTGACCTCCTGG + Intronic
948858854 2:240743276-240743298 CTTCTCTTTCCCTGACACCCTGG + Intronic
1173847681 20:46198395-46198417 CTGCTCATGGGCTGATGTCCCGG - Intronic
1174376922 20:50132388-50132410 CTCCTCTTTCGCTGCAGCCCAGG + Intronic
1176697837 21:10002190-10002212 CTCCTCTTTGGCTGACCTGCAGG + Intergenic
1180008641 21:45035080-45035102 CTGCTCTTTGGATGTGGTCCTGG - Intergenic
1180597436 22:16987970-16987992 CTGCTCTCTGGCTGGCGTGCTGG + Exonic
1183651313 22:39155504-39155526 CTGCTCTTCCGCTGTCGCCGTGG + Intergenic
1184536559 22:45091579-45091601 CCGCTCGCTCGCTGACGACCTGG + Intergenic
1184783463 22:46660383-46660405 CTCCTCTTTCCTTGTCGTCCTGG + Intronic
950719971 3:14875731-14875753 CTGCTCTACCTCTGAAGTCCAGG - Intronic
954685261 3:52366755-52366777 CTGCCCTTTCAGTGACGTCATGG - Exonic
959550044 3:107643920-107643942 CTGCTCTGTGGCTGATTTCCTGG + Intronic
961330378 3:126134792-126134814 TGGCTCTTTCGCTGGGGTCCTGG - Intronic
969423455 4:7110371-7110393 CTTCTCTCTGGCTGATGTCCAGG - Intergenic
969682955 4:8653286-8653308 CTGCTGTGTCGCTGAAGTCTTGG - Intergenic
971589108 4:28444009-28444031 CTGCTCATTTGCTGATGTGCAGG + Intergenic
980370384 4:131862063-131862085 CTCCTCTTTGGCTGACCTGCAGG + Intergenic
994944332 5:106366421-106366443 CTGCTCTTTCTCTGAAATCATGG - Intergenic
1001438956 5:171723544-171723566 TTGCTCTGTCGCTGTCGCCCAGG + Intergenic
1003812799 6:9803622-9803644 CTGCTCTTTTTCAGACTTCCAGG + Intronic
1004936559 6:20513681-20513703 TTGCTCTGTCGCTGTCGCCCAGG - Intergenic
1019449950 7:1092343-1092365 CTTCTGTTTCGCGGATGTCCGGG + Exonic
1022101018 7:27169256-27169278 CTGCTCCTTCGCGGACGCCGGGG - Intronic
1032521761 7:132550837-132550859 CTGGTCTCTCCCTGACCTCCTGG + Intronic
1036621100 8:10424903-10424925 CTGCTCCTTCGCTGTCCCCCGGG - Intronic
1042077494 8:65012621-65012643 ATGCTTTTTCGCTGGCTTCCAGG - Intergenic
1042108644 8:65355861-65355883 CTGCTTTTTCACTCAGGTCCTGG - Intergenic
1051503651 9:17804994-17805016 CTGCTCTTTCCCTAGTGTCCTGG - Intergenic
1053634961 9:39988549-39988571 CTCCTCTTTGGCTGACCTGCAGG + Intergenic
1053770967 9:41475759-41475781 CTCCTCTTTGGCTGACCTGCAGG - Intergenic
1054208926 9:62262148-62262170 CTCCTCTTTGGCTGACCTGCAGG - Intergenic
1054315887 9:63585992-63586014 CTCCTCTTTGGCTGACCTGCAGG + Intergenic
1054549701 9:66387589-66387611 CTCCTCTTTGGCTGACCTGCAGG - Intergenic
1189311115 X:40018261-40018283 AGGCTCTTTCTCTGTCGTCCAGG - Intergenic
1192067789 X:67904383-67904405 CTGCTTTTTCACTTAGGTCCTGG - Intergenic
1193605309 X:83560275-83560297 CTGCCCTTTAGCTGAGATCCAGG + Intergenic
1194268181 X:91779846-91779868 TTGCTCTTTCTCTTACCTCCCGG - Intronic
1202195564 Y:22296104-22296126 CTGGTCTTTCCTTGACGTCTGGG + Intergenic