ID: 1124233674

View in Genome Browser
Species Human (GRCh38)
Location 15:27968343-27968365
Sequence GGGGAATGACAGGGGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1119
Summary {0: 1, 1: 0, 2: 9, 3: 104, 4: 1005}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124233664_1124233674 18 Left 1124233664 15:27968302-27968324 CCACAAAGGGGGTCAGAGGCACA 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1124233674 15:27968343-27968365 GGGGAATGACAGGGGCAGGGTGG 0: 1
1: 0
2: 9
3: 104
4: 1005

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124233674 Original CRISPR GGGGAATGACAGGGGCAGGG TGG Intronic
900125470 1:1067240-1067262 GGGCCATGGCAGGGGCAGGGTGG + Intergenic
900337131 1:2169782-2169804 GGGGTATGACGGGGGCGGGGGGG + Intronic
900374621 1:2347761-2347783 GGGGGGTGACGGGGGCAGCGGGG - Intronic
900375884 1:2354579-2354601 GGGGGAGGCCAGGGTCAGGGAGG - Intronic
900389918 1:2429355-2429377 GGGGATTAACAGGGGCCAGGTGG - Intronic
900411462 1:2514569-2514591 GGGGACTGTCTGGGGCAGGGTGG + Intronic
900533825 1:3167621-3167643 GGAGGATGGCAGGAGCAGGGGGG - Intronic
900533845 1:3167681-3167703 GGAGGATGGCAGGAGCAGGGGGG - Intronic
900533865 1:3167741-3167763 GGAGGATGGCAGGAGCAGGGGGG - Intronic
900533885 1:3167801-3167823 GGAGGATGGCAGGAGCAGGGGGG - Intronic
900533945 1:3167977-3167999 GGAGGATGGCAGGAGCAGGGGGG - Intronic
900533985 1:3168095-3168117 GGAGGATGGCAGGAGCAGGGGGG - Intronic
900545978 1:3229404-3229426 GGAGAAAGACAGGGGCATGGGGG - Intronic
900619615 1:3580747-3580769 GTGGGATGGCAGGGCCAGGGTGG + Intronic
900911263 1:5598505-5598527 GGGGAAGTTCAGGGGCAGAGGGG + Intergenic
900940721 1:5796886-5796908 GAGGAATGACAGGTGGAGGAAGG + Intergenic
900993545 1:6108637-6108659 GTGGAAGGACAGAGGCATGGAGG + Intronic
901070098 1:6512714-6512736 GGGGAGGGACTGAGGCAGGGCGG - Intronic
901685339 1:10940602-10940624 GGAGACTGGCAGAGGCAGGGAGG - Intergenic
902332134 1:15735919-15735941 GGGGCATATCAGGGGCAGGGTGG + Intergenic
902445939 1:16464312-16464334 TAGGAATGACAGGCGAAGGGTGG + Intergenic
902470805 1:16646716-16646738 GGGGGTGGAGAGGGGCAGGGTGG + Intergenic
902487995 1:16760732-16760754 GGGGGTGGAGAGGGGCAGGGTGG - Intronic
902579173 1:17397453-17397475 AGGGTGGGACAGGGGCAGGGAGG + Intronic
902607385 1:17576195-17576217 GGGGTGGGACAGGGGCAGGCAGG + Intronic
902626577 1:17680072-17680094 GGGCAGGGGCAGGGGCAGGGTGG - Intronic
902675144 1:18003503-18003525 GGGGAAAGACAGGGCCAGGATGG - Intergenic
903049078 1:20587637-20587659 GGGGAAAGGCAGGGGAAAGGAGG - Intergenic
903345152 1:22679746-22679768 GGGGAATGCCCGGGGCAGAATGG - Intergenic
903564084 1:24251426-24251448 GGGTAGGCACAGGGGCAGGGCGG + Intergenic
903767107 1:25741949-25741971 GGGGTATGAGAGAGGCAGTGGGG + Intronic
903931298 1:26863978-26864000 GGGGACTGGAGGGGGCAGGGCGG - Exonic
904677071 1:32205264-32205286 AGAGAATGAGAGGGGCAGTGTGG - Exonic
904809329 1:33153077-33153099 GGGGAGTGACAGGTGCTGGATGG + Intronic
904941860 1:34169331-34169353 GGAGAATGAGAGGGGCAGGCAGG - Intronic
905816175 1:40952738-40952760 GGGGAAAACCAGGGGCTGGGAGG - Intergenic
905881033 1:41463875-41463897 GGGGACAGTCAGAGGCAGGGGGG + Intergenic
905884247 1:41483190-41483212 GGGGAATGGCAGGGGCCCTGTGG + Intronic
906153430 1:43600811-43600833 GAGGAATGGCAGGGGGAGGAGGG - Intronic
906360832 1:45157030-45157052 GGGGATTGACAAGGGCATGAGGG - Intronic
906636773 1:47415639-47415661 AGGGCATGACAGGGGTATGGGGG + Intergenic
906829823 1:49019303-49019325 GGAGGATGAGAGGAGCAGGGAGG - Intronic
907236467 1:53053772-53053794 ACTGAATGTCAGGGGCAGGGCGG + Intergenic
907316045 1:53573336-53573358 GGGGAAGGACAGTGGCGGTGGGG + Intronic
907484544 1:54768153-54768175 GGGGGAAGAGAGGGGCAGAGAGG - Intergenic
907796747 1:57725440-57725462 GGGGAAGGTCAGGGGAAGGCAGG - Intronic
908438598 1:64131230-64131252 GGTGTATGAAAGGGGCTGGGGGG + Intronic
908600813 1:65738019-65738041 GGGGACTGTCAGGGGGTGGGGGG - Intergenic
909387152 1:75070955-75070977 GGGAAATGAGGTGGGCAGGGTGG + Intergenic
909483679 1:76151526-76151548 GGGGAATGAGAAGGGGAGGAAGG + Intronic
909700590 1:78517535-78517557 GGGAAATTACTGGGGCAGGGTGG + Intronic
909736784 1:78971371-78971393 GGGGAATGAGAGAGCCAGGTGGG + Intronic
910831823 1:91469072-91469094 GGAGAAAGACAGAGGCTGGGAGG + Intergenic
911361462 1:96882277-96882299 GGTGATTGCCAGGGGCTGGGGGG + Intergenic
912721125 1:112020940-112020962 GGAAAATGAGAGGGGTAGGGAGG - Intergenic
912762770 1:112383747-112383769 GTGGAATGCCAGGGGCTGAGGGG - Intergenic
912963440 1:114216309-114216331 GGGGAGTGACGGAGGTAGGGAGG - Intergenic
913475275 1:119231006-119231028 GGGGACTGACAGGAGCAGCCAGG + Intergenic
914447398 1:147761354-147761376 GGGGAAAGATGGGGTCAGGGTGG + Intronic
914921128 1:151848071-151848093 GGGGAAGGAGAGTGGCAGGCAGG + Intronic
915229472 1:154434880-154434902 GGGGAGTGAACGGGGCTGGGTGG + Intronic
915621576 1:157089184-157089206 AGGGAATGAAAGGGGGAGGACGG + Intergenic
915733254 1:158068788-158068810 AGGGAATGACTGGGGTTGGGGGG + Intronic
915897426 1:159823063-159823085 GGGGACTGAAAGGGGAAGGTAGG - Intergenic
916622127 1:166510717-166510739 TGAGAGTGACAGGGGCAGGAGGG + Intergenic
917737441 1:177933433-177933455 AGGGAATGGCAGGGGAAGGAAGG + Intronic
918202438 1:182279950-182279972 GGGGACTGAAAGGGGGATGGGGG - Intergenic
919475949 1:198034219-198034241 GGGCAAAGACAGGAGCAGGAAGG + Intergenic
919509761 1:198447622-198447644 GGGAAAGGAAAGGGGGAGGGAGG - Intergenic
919609020 1:199722150-199722172 GGGGAATAACGGGGAAAGGGAGG - Intergenic
919708520 1:200702949-200702971 GGTTAAGGACAGGGGTAGGGAGG + Intergenic
919727993 1:200896088-200896110 GGGGACTTACAGGGACAGAGGGG - Intronic
919754247 1:201056790-201056812 AGGGGATGAAAGGAGCAGGGAGG - Intronic
919769028 1:201145355-201145377 GGAGAATGACAGTTGCAGGAGGG + Intronic
919847172 1:201649446-201649468 GGAGAAAGCCAGGGGCGGGGCGG - Intronic
919985679 1:202672756-202672778 GGGAAATGAGAGAGGGAGGGAGG + Intronic
920211713 1:204333196-204333218 AGGAAGGGACAGGGGCAGGGAGG + Intronic
921575576 1:216831001-216831023 GAGGAAGGAAAGGGGCAAGGTGG + Intronic
921702119 1:218280609-218280631 GGGAAAGGCCAGAGGCAGGGTGG - Intergenic
921761740 1:218923230-218923252 GGGGAAGGAAAGAGGGAGGGAGG - Intergenic
922118044 1:222633717-222633739 GGGGAAGGATGTGGGCAGGGGGG + Intronic
922565797 1:226600912-226600934 GGCGAATGACAGAGGAAAGGAGG - Intronic
922798139 1:228351629-228351651 GGGGGGTGACAGTGGCATGGTGG - Intronic
923009555 1:230077282-230077304 GGGGCAGGACAAGGGCAGGAGGG - Intronic
923092776 1:230752591-230752613 GGGGGAGGGGAGGGGCAGGGAGG + Intronic
923165287 1:231355709-231355731 GGGGAAGGGTAGTGGCAGGGAGG + Intergenic
923371887 1:233322761-233322783 GGGGAAGTGCTGGGGCAGGGTGG - Intergenic
923611358 1:235497916-235497938 GGGGATTGAGAGTGGCAGAGAGG - Intronic
924091866 1:240509686-240509708 GGGGAGAGAAAGGGGCAGGGAGG - Intronic
924423919 1:243933774-243933796 AGGGAATGGCAGGGGAGGGGAGG - Intergenic
924591334 1:245407223-245407245 GGGGAAGAACCGGGGCAGGGTGG + Intronic
1062813900 10:485265-485287 GGGAACTCACAGGGACAGGGCGG + Intronic
1062853049 10:760025-760047 GGGTGATGACAGTGGCAGGACGG - Intergenic
1063962625 10:11319413-11319435 GGGGAAGCACAGCGGCAGGGAGG + Intronic
1064030990 10:11882747-11882769 GGTAAATGACAAGGCCAGGGAGG + Intergenic
1064031528 10:11886053-11886075 GGAGACTGGCAGGGGCGGGGTGG + Intergenic
1064179133 10:13100013-13100035 GGGGTATGGAATGGGCAGGGTGG + Intronic
1064346863 10:14540527-14540549 GGGGGAGGACAGAGGGAGGGTGG - Intronic
1065034278 10:21621651-21621673 GGGAGATGGCAGGGGCAGGGAGG + Intronic
1065503143 10:26401396-26401418 GGTGGATGACAGTGGCAAGGAGG - Intergenic
1065699428 10:28410520-28410542 GAGGCATCTCAGGGGCAGGGAGG - Intergenic
1066370391 10:34814777-34814799 GGGGGAGGAGAGGCGCAGGGAGG - Intronic
1066442150 10:35449269-35449291 GGGCAGAGATAGGGGCAGGGAGG + Intronic
1066672231 10:37852484-37852506 GGGGAATGACAGGGCCAGGATGG + Intronic
1066991130 10:42515092-42515114 GGGCAAAGAGAGGGGGAGGGAGG - Intergenic
1067057463 10:43060649-43060671 GGGCAAGGGCAGGGGCCGGGAGG + Intergenic
1067110696 10:43397397-43397419 GGGGAAGGAGAGAGTCAGGGCGG + Intronic
1067286314 10:44910003-44910025 GGGGAAGGAGAAGGGGAGGGAGG + Intergenic
1067359308 10:45563014-45563036 GGGGAAGGAGAGAGGAAGGGAGG - Intronic
1068082748 10:52340032-52340054 GGTGATTGCCAGGGGCTGGGAGG + Intergenic
1068883722 10:62076942-62076964 GGGAGATGAGAGTGGCAGGGTGG - Intronic
1069854370 10:71431724-71431746 GGGGAAGGAAAAGGGCAGGAGGG - Intronic
1070025300 10:72626237-72626259 GGGGAGTGACGGGGCTAGGGCGG - Intergenic
1070062710 10:73000598-73000620 TGGGAATTACAAGGGCATGGTGG + Intergenic
1070329122 10:75405474-75405496 GGGGCAGGACAGGGGTGGGGAGG - Intergenic
1070381430 10:75883708-75883730 AGGGAATGAAAGGAGGAGGGGGG + Intronic
1070749773 10:78957131-78957153 GGGGAATGACAGGGCCAGGCTGG + Intergenic
1070967715 10:80539684-80539706 GAGGAATGACAATGACAGGGTGG - Intronic
1071000276 10:80823800-80823822 GGTGACTGTCAGGGGCTGGGGGG + Intergenic
1071348516 10:84716108-84716130 GGAGCATGACAGGGACAAGGCGG - Intergenic
1071450799 10:85790215-85790237 GGGGAATGACAGGGGACGAAGGG - Intronic
1072390147 10:94975512-94975534 GGAGAATGAGAGTGTCAGGGAGG + Intronic
1072422063 10:95297484-95297506 GTGGAATGAGAGGGGCTGGCGGG - Intergenic
1072552006 10:96486422-96486444 GGGAAATGCTTGGGGCAGGGAGG - Intronic
1072574572 10:96688195-96688217 GGGGAATGACATTGGCTGGGAGG - Intronic
1072921426 10:99580132-99580154 GGGGAAACACAGGGGCTGTGTGG + Intergenic
1073067293 10:100770224-100770246 GGGGATGGACAGGTGCAGAGTGG + Intronic
1073122470 10:101131193-101131215 GGTGAATGACAGCGCGAGGGAGG - Exonic
1073206253 10:101770933-101770955 GGGGGGTGAGAGGGGCAGGTGGG - Intronic
1074281796 10:112059158-112059180 GGGGAAAGGGAGGGGAAGGGTGG - Intergenic
1074756319 10:116627032-116627054 GGGGTCAGAGAGGGGCAGGGAGG + Intronic
1074919002 10:117988287-117988309 GAGGCAAGACAGGAGCAGGGTGG - Intergenic
1074948694 10:118306329-118306351 AGGGAATGAAAGGGGAAGGGAGG - Exonic
1075185469 10:120252113-120252135 GGGGGTTGACTGGGGCATGGCGG + Intergenic
1075612066 10:123862286-123862308 GTGGAATGCCTGGGGCATGGCGG - Intronic
1075743525 10:124710503-124710525 GGGGAATGCCAGGACCAGGCCGG + Intronic
1076143465 10:128097774-128097796 GGGAATAGAAAGGGGCAGGGAGG - Exonic
1076164649 10:128271969-128271991 GGGGCTTGCCAGGGGCAGTGAGG - Intergenic
1076443369 10:130495589-130495611 AAGGAATGGCAGGGGCAGGAGGG + Intergenic
1076764414 10:132625218-132625240 GGGGAAGGACAGGGACAGGCAGG - Intronic
1076861474 10:133140147-133140169 GGGGCAAGACAGGGGCAGCACGG - Intergenic
1076870347 10:133189829-133189851 GGGGCAGGGCTGGGGCAGGGTGG - Intronic
1076871703 10:133197920-133197942 GGGGGCTGGCAGGGGCAGGCAGG - Intronic
1077071439 11:675924-675946 GGGGGATGTCAGGTGCTGGGGGG - Intronic
1077071548 11:676244-676266 GGGGGATGTCAGGTGCTGGGGGG - Intronic
1077190707 11:1254961-1254983 GGGGAATGAGTGGGGGAGGGGGG + Intronic
1077235854 11:1481724-1481746 GGGCAGGGGCAGGGGCAGGGAGG + Intronic
1077235865 11:1481746-1481768 GGGCAGGGGCAGGGGCAGGGAGG + Intronic
1077239732 11:1504209-1504231 GGAGACTGGCAGGGGCAAGGAGG + Intergenic
1077349662 11:2086596-2086618 GAGGAATGCCAGGGGCGGGGTGG + Intergenic
1077367636 11:2167520-2167542 GGGGAGTGAGAAGGGCAGGAGGG + Intronic
1077552306 11:3206128-3206150 GGGAAATGAAAAGGGAAGGGGGG - Intergenic
1077981296 11:7303283-7303305 GGGGAATGTCAGGGGAGGTGTGG - Exonic
1078059558 11:8034276-8034298 GGGGAAGGACAGTGGGAGTGGGG + Intronic
1078661386 11:13289534-13289556 GGGGCCTGTCAGGGGCTGGGGGG - Intronic
1078926400 11:15879449-15879471 GGGGAATGTAAGGAGGAGGGAGG + Intergenic
1079122020 11:17692738-17692760 GGGAAAAGCCAGGGGTAGGGGGG + Intergenic
1079444317 11:20545756-20545778 GGGGAAGGGCAGAGGAAGGGCGG - Intergenic
1080606552 11:33869313-33869335 CGGGGGTGGCAGGGGCAGGGGGG + Intronic
1080628455 11:34051982-34052004 GGGAAATGACCGGGGTGGGGTGG - Intronic
1080645741 11:34186388-34186410 GGGGGAGGACAGGAGCTGGGTGG - Intronic
1080790858 11:35521353-35521375 GGGGAATGAGAGGGAGAAGGTGG - Intronic
1080826440 11:35852943-35852965 GGGGAGAGAGAGGGTCAGGGAGG + Intergenic
1081568573 11:44275712-44275734 GGGGAATGTCAGGGGGAGAGTGG + Intronic
1081913786 11:46718353-46718375 GGGGAGGGACAGGAGTAGGGCGG + Intergenic
1082777510 11:57258734-57258756 GGGGAATGACAGACACTGGGTGG + Intergenic
1082892010 11:58149626-58149648 GGTGATTGCCAGTGGCAGGGGGG - Intronic
1083199188 11:61109634-61109656 GAGGAATGAGAGGGACAGGGAGG + Intronic
1083340384 11:61955307-61955329 GGGGAACGCCAGCGGCAGGTCGG + Intronic
1083489014 11:63001135-63001157 GGGCTATGTGAGGGGCAGGGAGG - Intronic
1083661182 11:64252401-64252423 GGGGCAGGACAGGGAAAGGGGGG - Intronic
1083738284 11:64694191-64694213 GGGGAGTGAGTGGGGCTGGGGGG - Intronic
1083814927 11:65127401-65127423 GGGAAAAGACAGGGGCAGGCAGG + Exonic
1083886873 11:65577268-65577290 GGGGAAGGGCTGGGGCAGGAAGG + Intronic
1083913032 11:65720991-65721013 GGGGAAGGAGAGGGGGAGAGGGG - Intergenic
1083920829 11:65780791-65780813 GGGACAGGACAGGAGCAGGGCGG + Exonic
1084020447 11:66414121-66414143 GAGGAAGCACAGGGGCTGGGGGG + Intergenic
1084406826 11:68979112-68979134 TGGGAAGGAAAGGGGGAGGGAGG + Intergenic
1084584718 11:70051170-70051192 GGGTAATGACTGGGGGTGGGTGG - Intergenic
1084784485 11:71434224-71434246 TGGGAGGGAGAGGGGCAGGGTGG + Intronic
1084937997 11:72597465-72597487 GGGCAGGGGCAGGGGCAGGGAGG - Intronic
1084938174 11:72598370-72598392 AGGGTATGACAGTGGCAGAGGGG + Intronic
1084973610 11:72784496-72784518 TGGGGGTGACTGGGGCAGGGAGG + Intronic
1085022412 11:73217950-73217972 GGGGCGGGACAGGGGTAGGGTGG + Intergenic
1085085597 11:73664467-73664489 GGGGAAGGGGAGGGGGAGGGGGG - Intergenic
1085305573 11:75483812-75483834 AGTGAATGCCAGGGGCTGGGAGG + Intronic
1085525791 11:77162775-77162797 GGGCAAAGACATGGGCAGGGAGG + Intronic
1085725661 11:78952473-78952495 AGGGAGAGACAGGGGCAGGGAGG + Intronic
1085928781 11:81055725-81055747 GGAAAAGGACAGGGGCAGCGGGG - Intergenic
1087733307 11:101802765-101802787 GGGGCCTGTCAGGGGTAGGGGGG + Intronic
1087797555 11:102470449-102470471 GGGGAAGGGCAGGGGTTGGGAGG + Intronic
1087811154 11:102610347-102610369 GGAGAACGACTGGGGCGGGGCGG + Intronic
1088626144 11:111732042-111732064 GGGGAAGGAGAGCAGCAGGGAGG + Intronic
1088920963 11:114259504-114259526 GGGGCAGGAGAGGGGCTGGGGGG + Intronic
1088923714 11:114280507-114280529 GGGGATTCTCTGGGGCAGGGCGG - Intronic
1089064269 11:115650566-115650588 GGTGGATGGTAGGGGCAGGGAGG - Intergenic
1089178813 11:116566863-116566885 GGGGAAAGACAGGGGTTGTGGGG - Intergenic
1089251739 11:117168413-117168435 GGGGAATGAAGGGGAAAGGGGGG - Exonic
1089294781 11:117461085-117461107 GGGGCATGATAGGGGCAGATTGG - Intronic
1089508107 11:118978608-118978630 GGGGAATGAGAAGGTCAGAGAGG + Intronic
1089629137 11:119773015-119773037 GGGGAAGAACAAGGTCAGGGAGG - Intergenic
1089661938 11:119991646-119991668 GGAAAATGGCAGGAGCAGGGTGG + Intergenic
1090172456 11:124616932-124616954 TGGGAAGGAGAGGGGAAGGGAGG - Intronic
1090187343 11:124747073-124747095 CGGGACCGACAGGGGCGGGGCGG - Exonic
1090450918 11:126805721-126805743 AGGGAAGGACAGGGAGAGGGAGG + Intronic
1090617564 11:128529372-128529394 TGGGAATGAAAAGGACAGGGAGG + Intronic
1091168739 11:133502314-133502336 AGGGACAGACAGAGGCAGGGTGG + Intronic
1091229204 11:133976961-133976983 GGAGAACCACAGGGCCAGGGAGG - Intergenic
1091749309 12:3012571-3012593 GCGGAGTGGCAGGGGCATGGGGG + Intronic
1091777229 12:3192409-3192431 GGAGGATGCCAGGTGCAGGGAGG + Intronic
1091820339 12:3471219-3471241 CGGGAAGGAGAGGGGCAAGGTGG + Intronic
1092197987 12:6561644-6561666 TGGGTATGAGAGGGGCAGGCAGG - Exonic
1092246367 12:6866537-6866559 GGGGAAAGACTGAGGCAGGAGGG - Exonic
1092559154 12:9591636-9591658 GTGGAATGGGTGGGGCAGGGAGG + Intergenic
1093077367 12:14771696-14771718 GGGGAATGGCGGGGGTCGGGGGG - Intergenic
1093109549 12:15132970-15132992 GGGGCAGGGCGGGGGCAGGGAGG - Intronic
1093141633 12:15516563-15516585 GGGGGAGGGCAGGGGGAGGGAGG + Intronic
1096801963 12:54116389-54116411 AGGGAATGACAGTGCCAAGGAGG + Intergenic
1096804921 12:54134744-54134766 GGGGAATGTGAGGAGCAAGGAGG + Intergenic
1096836008 12:54351904-54351926 GGGGAATGACGGGGGGCTGGAGG - Intergenic
1097053431 12:56237013-56237035 TAGGAATGGCAGGAGCAGGGTGG + Intronic
1097178342 12:57156493-57156515 GGGGAATGGGAGGGACAGAGTGG - Intronic
1097427964 12:59470843-59470865 GGGGCCTGACAGGGGACGGGGGG - Intergenic
1098161010 12:67648582-67648604 GGGGACTGAGAGGAGCCGGGCGG + Intronic
1098283012 12:68880394-68880416 GGGGAAAGAAAGGGACAGGTAGG + Intronic
1098382597 12:69884492-69884514 GAGGGTGGACAGGGGCAGGGAGG - Intronic
1098449351 12:70601879-70601901 GGGGAATGGCAGGACCTGGGAGG - Intronic
1098762035 12:74436217-74436239 GGAGTGTCACAGGGGCAGGGAGG + Intergenic
1099804053 12:87495030-87495052 GGTGAATGAAAGGTTCAGGGAGG + Intergenic
1100026539 12:90135371-90135393 GGGGAATGGTAGGGGGAGAGAGG + Intergenic
1100089151 12:90949067-90949089 GGGCAAGGGCAGGGGCAGAGGGG + Intronic
1100190015 12:92180339-92180361 GGAGAATGAATGGGTCAGGGAGG - Intergenic
1100241036 12:92710813-92710835 GGGCAATGACAGGGGCAGCTGGG + Intergenic
1101356198 12:103979620-103979642 GGGGAAGGAGAGTGGCATGGGGG + Intronic
1101655035 12:106712605-106712627 GGGGCAGGACAGGAGCAGTGAGG - Intronic
1101657301 12:106734147-106734169 GGTGAATGTCAGGGGCTGGAGGG + Intronic
1101755512 12:107618081-107618103 GGGGCAGGGCAGGGGCAGGCTGG - Intronic
1101816136 12:108147487-108147509 AGGGATTGGCAGGGGAAGGGAGG + Intronic
1101858395 12:108463024-108463046 AGGGAAAGACAGAGGAAGGGAGG + Intergenic
1102198965 12:111044372-111044394 GGAGAATGACAGGGGACGGGAGG - Intronic
1102214000 12:111147440-111147462 GGGAAAAGACAGGGGCACAGTGG - Intronic
1102216757 12:111167112-111167134 AGAGACAGACAGGGGCAGGGAGG - Intronic
1102524989 12:113506068-113506090 GGGTGAGGACAGGAGCAGGGAGG - Intergenic
1102551896 12:113697436-113697458 AGGAAATGTCAGGTGCAGGGAGG + Intergenic
1102598672 12:114012673-114012695 GGGGAAGGAGAGGGGGAGGGAGG + Intergenic
1102613713 12:114134630-114134652 TGGGACTGAGAGGGGCAGGCAGG - Intergenic
1102675374 12:114654515-114654537 GGGGAATGGAAGGGGAGGGGAGG + Intergenic
1102825788 12:115946894-115946916 GGGGGTTTACAGGGGCAGGGAGG + Intergenic
1103238961 12:119397888-119397910 GGGGGAGGAAGGGGGCAGGGTGG + Intronic
1103238972 12:119397909-119397931 GGGGAAGGAAGGGGGCGGGGAGG + Intronic
1103344637 12:120241190-120241212 GTGATCTGACAGGGGCAGGGTGG - Intronic
1103458556 12:121086212-121086234 GAGGAAGGACAGGAGCAGGGAGG - Intergenic
1103905980 12:124327371-124327393 GGGGACAGACGGGGGCGGGGCGG + Intronic
1104087856 12:125492641-125492663 GGGGTCTGAGAGGGGCAGGAAGG + Intronic
1104337904 12:127918039-127918061 GGGAAAGGACAAGGGCAGGCAGG - Intergenic
1104894450 12:132154980-132155002 GGGGAAGCACAGGGGGAGAGAGG - Intergenic
1104971497 12:132532826-132532848 GGGGCATGCCTGGGACAGGGAGG + Intronic
1105460655 13:20582565-20582587 GGAGAAAGACAGGGGGATGGTGG + Intronic
1105644939 13:22307095-22307117 GGGGCCTGTCAGGGGCTGGGGGG - Intergenic
1106168021 13:27266175-27266197 GAGGAAGGAAAGGGGAAGGGAGG - Intergenic
1106235805 13:27859251-27859273 AGTGATTGACAGGGGCAGGCAGG + Intergenic
1106264911 13:28100872-28100894 GGGGACTCACAGGGGCAGCAAGG - Intergenic
1106313892 13:28577138-28577160 GGTGAATGAGAGGGGCAGAGGGG + Intergenic
1107184524 13:37503043-37503065 GGGGCCTGTCAGGGGCTGGGGGG + Intergenic
1107338291 13:39379603-39379625 GGTGACTGACTGGGGTAGGGAGG - Intronic
1107425384 13:40287808-40287830 GGGGAATGACGGTTGCAGGAGGG + Intergenic
1107863728 13:44683477-44683499 GGGGAGGGAGAGGGGGAGGGGGG + Intergenic
1107925559 13:45258389-45258411 GGAGAATGAAAGTGGGAGGGAGG - Intronic
1108396645 13:49996917-49996939 GGGGAAAGGGAGGGGGAGGGGGG + Intronic
1110686421 13:78380622-78380644 GGGGCATGTCAGGGGTTGGGGGG - Intergenic
1111011419 13:82320165-82320187 GGGCAGGGGCAGGGGCAGGGGGG - Intergenic
1111056671 13:82959134-82959156 GGGGCCTGTCAGGGGCTGGGGGG + Intergenic
1111407380 13:87826306-87826328 GGGGACTGTCAGGGGACGGGGGG - Intergenic
1111587621 13:90303196-90303218 GGGGCATGTCAGGGGGTGGGGGG - Intergenic
1111633246 13:90870473-90870495 GGGGAAGGACAAGGGAAGGTGGG - Intergenic
1111897423 13:94158548-94158570 GGGGAAGGACAGAAGCAGGCAGG + Intronic
1112080108 13:95959754-95959776 TGGGAATGACAGTGGTAGGTAGG - Intronic
1113064367 13:106358682-106358704 GGAGGATGGGAGGGGCAGGGAGG - Intergenic
1113372644 13:109737067-109737089 AGGGAAGGCGAGGGGCAGGGTGG + Intergenic
1113578615 13:111412357-111412379 GGGCAATGACAGCAGCAGGAAGG + Intergenic
1114351878 14:21861575-21861597 GGGGGCTGACAGGGGAAGGGAGG + Intergenic
1115402249 14:32975301-32975323 AGGGAGTGACGGAGGCAGGGAGG - Intronic
1115489073 14:33941525-33941547 GGGGAATGACGGGGGAAGATGGG - Intronic
1115498248 14:34027365-34027387 GGGGAGGGAGAGGGGGAGGGAGG + Intronic
1115896045 14:38088531-38088553 TGGGAATCACAGAGGCAGGGAGG - Intergenic
1116075070 14:40100855-40100877 GGGGGAGGAGAGGGGAAGGGAGG - Intergenic
1116628450 14:47297506-47297528 AGGGAAGGGAAGGGGCAGGGAGG + Intronic
1117501798 14:56359749-56359771 GGGGCCTGTCAGGGGCTGGGGGG - Intergenic
1118543414 14:66857787-66857809 GGGGTATGACTGGGGAGGGGTGG - Intronic
1118905635 14:70021244-70021266 GGGGAAAGGCAGGGACAGGCAGG + Intronic
1118914615 14:70092371-70092393 GAGGCATGACAGGGGCAGGGTGG - Intronic
1118992341 14:70808714-70808736 GGGGAATGACGGAGGCCTGGGGG - Intronic
1119235412 14:73015335-73015357 GGGGAAGGAAAGGGGAAGGAAGG + Intronic
1119473172 14:74911764-74911786 GCAGAGTGGCAGGGGCAGGGTGG + Intronic
1119673803 14:76539096-76539118 AGGGAAGGAAAGGGGGAGGGAGG - Intergenic
1120008242 14:79384257-79384279 GGGGGAAGAGAGGGGAAGGGAGG + Intronic
1120873776 14:89360479-89360501 GGGGAAGGAAAGAGGAAGGGAGG + Intronic
1121262413 14:92576063-92576085 GGGTCAAGACAGGAGCAGGGAGG + Intronic
1121263272 14:92581903-92581925 GGGAAACATCAGGGGCAGGGAGG + Intronic
1122077563 14:99245935-99245957 GGGGACCGACGGGGGCGGGGGGG + Intronic
1122152226 14:99731391-99731413 GGGGACTCACAGTGGGAGGGAGG + Intergenic
1122246493 14:100406913-100406935 AGGGAATGAAAGGAGAAGGGGGG - Intronic
1122265030 14:100542535-100542557 GGGGAGGGACAGGAGCTGGGTGG - Intronic
1122751218 14:103934785-103934807 GGGCAAGGACAGGAGCAGGGTGG + Intronic
1122959654 14:105088535-105088557 GGGGAGGGACACGGACAGGGCGG - Intergenic
1123049452 14:105533705-105533727 GGGTAATGGCAGAGGGAGGGTGG - Intergenic
1123066676 14:105622563-105622585 GGGGAGTGTCAGGGACAGGTGGG + Intergenic
1123095802 14:105766509-105766531 GGAGAGTGTCAGGGGCAGGTGGG + Intergenic
1123407536 15:20030145-20030167 GGGTACTGGCAGGAGCAGGGTGG - Intergenic
1123441397 15:20294753-20294775 GGGAAGTGAAAGGGGCAGTGTGG + Intergenic
1123516864 15:21036801-21036823 GGGTACTGGCAGGAGCAGGGTGG - Intergenic
1124233674 15:27968343-27968365 GGGGAATGACAGGGGCAGGGTGG + Intronic
1125311136 15:38379272-38379294 GGGGCATGTCGGGGGCTGGGGGG - Intergenic
1125362352 15:38877397-38877419 GGGCCATCACTGGGGCAGGGTGG + Intergenic
1125561164 15:40634756-40634778 GGGGAAGGATAGGAACAGGGAGG + Intronic
1125595999 15:40886451-40886473 GAGGGATGACAGTAGCAGGGAGG + Intergenic
1125626720 15:41115604-41115626 GGGGGTGGGCAGGGGCAGGGCGG - Intronic
1125744921 15:41991503-41991525 GGGTTATCACAGGGGCAGGGTGG + Intronic
1125761091 15:42096017-42096039 TGGGGATGACAGGGGCAGGGAGG - Intergenic
1125763972 15:42120704-42120726 GTGGGATGATGGGGGCAGGGAGG - Intergenic
1126176695 15:45742743-45742765 GGGAAATGACAGGGGCAAGGGGG - Intergenic
1126556069 15:49988963-49988985 GGGGAAAGACAGGTGGAGGTTGG - Intronic
1126684891 15:51240054-51240076 GGGGAGTGGCCGGGGGAGGGGGG - Intronic
1126940394 15:53759728-53759750 GGGGCAGGACCGGGGCGGGGCGG - Intronic
1127375086 15:58376874-58376896 GGGGGATGAGAGGGGAAGGAAGG + Intronic
1127896762 15:63307173-63307195 GGGGAGTGACAGTGGCAGGACGG + Exonic
1128231205 15:66036679-66036701 GAGGAAGGAAAGGGGCGGGGAGG + Intronic
1128331770 15:66760843-66760865 GAGGGATGACAAGGGCAGGAAGG - Intronic
1128334680 15:66778399-66778421 GGGGAAGGACAGGGGCACAGGGG - Intronic
1128346920 15:66859875-66859897 AGGGAAGGACAGGGGCAGGGTGG - Intergenic
1128417211 15:67457874-67457896 GGAGAAGGACAGGGGCAGCTTGG - Intronic
1128519569 15:68366550-68366572 GAGGAAGGAGAGGGGCAGGGTGG - Intronic
1128765250 15:70247449-70247471 GGGGAAGGCCCTGGGCAGGGAGG + Intergenic
1128794359 15:70454094-70454116 GGGGCCTGCAAGGGGCAGGGTGG + Intergenic
1128818252 15:70629885-70629907 GGGTGCTGACAGAGGCAGGGAGG - Intergenic
1128916395 15:71566754-71566776 TGGGAATGGCAGGGGGAGCGGGG - Intronic
1129020553 15:72513806-72513828 GGGGAGGGAGAGGGGGAGGGAGG - Intronic
1129167314 15:73786064-73786086 GAGGCATCAGAGGGGCAGGGAGG + Intergenic
1129252053 15:74314570-74314592 GGGGGCTGGCAGGGGGAGGGTGG - Intronic
1129442102 15:75588909-75588931 GGGGAAGAAAAGGGGAAGGGAGG + Intergenic
1129444587 15:75608024-75608046 GGGGAAAGACATGGGATGGGTGG + Intronic
1129455476 15:75674279-75674301 GGGGAAGGACAGGGGTATGGAGG + Intergenic
1129659426 15:77544683-77544705 GGGGAATGAGAGGGGGAGCAGGG + Intergenic
1129797235 15:78387170-78387192 GGGGAAAGACAGGGGGTGGCGGG - Intergenic
1130012309 15:80161140-80161162 GGGGAGTGAGAGGGGCTGGGAGG - Intronic
1131011487 15:89021773-89021795 AGGGAATGGCAGGGCCAGGGTGG - Intergenic
1131047183 15:89323677-89323699 GGGGCCTCCCAGGGGCAGGGTGG + Intronic
1131442121 15:92467136-92467158 GTGGAATGACAGGGGCCTGTTGG - Exonic
1131826339 15:96324641-96324663 GAGGAATGAGATGGGCAGGGAGG + Intergenic
1132180908 15:99752308-99752330 GCAGAATGGCAGGGCCAGGGAGG + Intergenic
1132643466 16:988385-988407 GAGGGATGGGAGGGGCAGGGAGG - Intergenic
1132719162 16:1307473-1307495 GGGGAATGAGTGAGGGAGGGAGG + Intergenic
1133026834 16:2992262-2992284 GGGGGAGGACAGGGGATGGGTGG + Intergenic
1133039416 16:3052472-3052494 GGGGTAGGATAGAGGCAGGGAGG + Intronic
1133043259 16:3072105-3072127 GGGGTAGGATAGAGGCAGGGAGG + Intronic
1133117790 16:3587981-3588003 GGGGACTGAAATGAGCAGGGAGG + Intronic
1133392680 16:5422530-5422552 GGCGCATGAGGGGGGCAGGGAGG + Intergenic
1133681893 16:8127382-8127404 GGGGAGTTGCAGGGGAAGGGAGG + Intergenic
1133962952 16:10510389-10510411 AGGGAAGGAGAGGGGAAGGGAGG + Intergenic
1133964384 16:10519768-10519790 GGGGAAGGGAAGGGGAAGGGAGG - Intergenic
1134235706 16:12464020-12464042 GGGGGTTGCCAGGGGCTGGGGGG - Intronic
1134493328 16:14712314-14712336 GGGGAAGGGGAGGGGAAGGGGGG - Intronic
1134498709 16:14751438-14751460 GGGGAAGGGGAGGGGAAGGGGGG - Intronic
1134520011 16:14914269-14914291 GGGGAAGGGTCGGGGCAGGGAGG - Intronic
1134525263 16:14938068-14938090 GGGGAAGGGGAGGGGAAGGGGGG - Intronic
1134547629 16:15122840-15122862 GGGGAAGGGGAGGGGAAGGGGGG + Intronic
1134551522 16:15141068-15141090 AGGGACTGGCAGGGGCTGGGCGG - Intergenic
1134553922 16:15151968-15151990 GGGGAAGGGTCGGGGCAGGGAGG + Intergenic
1134591088 16:15453955-15453977 GAGGAAGGAAAGGGGAAGGGAGG - Intronic
1134707684 16:16312923-16312945 GGGGAAGGGTCGGGGCAGGGAGG - Intergenic
1134712851 16:16336552-16336574 GGGGAAGGGGAGGGGAAGGGGGG - Intergenic
1134953976 16:18372141-18372163 GGGGAAGGGGAGGGGAAGGGGGG + Intergenic
1134959859 16:18399202-18399224 GGGGAAGGGTCGGGGCAGGGAGG + Intergenic
1135190818 16:20353039-20353061 GGTCACTGACAAGGGCAGGGTGG + Intronic
1135312797 16:21419015-21419037 GGGGAAGGGGAGGGGAAGGGGGG + Intronic
1135365720 16:21851295-21851317 GGGGAAGGGGAGGGGAAGGGGGG + Intronic
1135446094 16:22519867-22519889 GGGGAAGGGGAGGGGAAGGGGGG - Intronic
1135589588 16:23695399-23695421 GGGTGATGGCGGGGGCAGGGGGG + Intronic
1136109189 16:28054055-28054077 GGGGAGTGACAGACGCAGGGCGG - Intronic
1136151957 16:28356766-28356788 GGGGAAGGGGAGGGGAAGGGGGG + Intronic
1136168213 16:28470637-28470659 GGGGAAGGGGAGGGGAAGGGGGG + Intronic
1136211121 16:28758516-28758538 GGGGAAGGGGAGGGGAAGGGGGG - Intronic
1136244921 16:28969490-28969512 AGGGGGTGACAGGGGTAGGGAGG - Intergenic
1136287450 16:29252851-29252873 AGGGAAGGTGAGGGGCAGGGAGG + Intergenic
1136322910 16:29499523-29499545 GGGGAAGGGGAGGGGAAGGGGGG + Intronic
1136437594 16:30239491-30239513 GGGGAAGGGGAGGGGAAGGGGGG + Intronic
1136454136 16:30370786-30370808 GGTGAATGACCGCGGAAGGGCGG + Intergenic
1136591888 16:31222768-31222790 GGGGGAGGACAAGGGCTGGGGGG - Intronic
1136611031 16:31365203-31365225 GGGGAAAGTCAGGGGCATGAGGG + Intronic
1137384865 16:48031923-48031945 GAGGAATGACAAGGGTAGGAAGG - Intergenic
1137389686 16:48070996-48071018 GGGGCATTGCAGAGGCAGGGAGG + Intergenic
1137520008 16:49184443-49184465 GAGGAATGATACAGGCAGGGTGG + Intergenic
1137782112 16:51106306-51106328 GGGGAGTGTCAGGGGCCTGGAGG - Intergenic
1138384458 16:56626637-56626659 AGGGAATGACACGGGCAATGAGG - Intronic
1138385557 16:56633511-56633533 AGGGAATGACACGGGCAATGAGG - Intronic
1139016265 16:62692475-62692497 AGGGAGGGACAGAGGCAGGGAGG + Intergenic
1139231519 16:65287514-65287536 CAGGAAGGACAGGGACAGGGAGG - Intergenic
1139661755 16:68425599-68425621 CTGTGATGACAGGGGCAGGGAGG + Intronic
1139751584 16:69112189-69112211 GGGCTAGGGCAGGGGCAGGGAGG + Intronic
1139857151 16:69990144-69990166 GGGGAAGGGGAGGGGAAGGGGGG + Intergenic
1139947300 16:70650121-70650143 GGGCTAAGACAAGGGCAGGGTGG + Intronic
1139965067 16:70740785-70740807 GAGGAATGAGGGAGGCAGGGTGG + Intronic
1140426494 16:74865943-74865965 AGGGAAGGAAAGGGGCGGGGAGG + Intergenic
1140599584 16:76459145-76459167 GAGAAATGCCAGGGGCAGGTGGG + Intronic
1141173425 16:81704686-81704708 GGAGGGTGACGGGGGCAGGGAGG - Intronic
1141209682 16:81965665-81965687 GGGAAATGAGAGGGGAAAGGCGG + Intergenic
1141239111 16:82248633-82248655 GTGGAAAGAGAGGGGAAGGGAGG + Intergenic
1141622393 16:85243361-85243383 GGGGAAGGACACGGGCAGTGGGG + Intergenic
1141927573 16:87179235-87179257 GGGCCAGGACAGGGGCCGGGAGG + Intronic
1142093065 16:88225480-88225502 AGGGAAGGTGAGGGGCAGGGAGG + Intergenic
1142145885 16:88492819-88492841 GGAGAAGGAGAGGGGCTGGGAGG - Intronic
1142201165 16:88761767-88761789 GGGGAAGGACAGGCCCTGGGAGG - Intronic
1142233693 16:88911500-88911522 TCTGAAGGACAGGGGCAGGGAGG + Intronic
1142424332 16:89992982-89993004 GTGGATTGCCAGGGGCAGGACGG - Intergenic
1142604763 17:1075294-1075316 GGGCAGTGACAGAGGCAGGTTGG + Intronic
1142686999 17:1583173-1583195 GGGGAGTGGGAGGGGCAGGTGGG - Intronic
1143108850 17:4542538-4542560 GGGGAGTGACAAGGGCTGTGAGG + Intronic
1143158006 17:4850984-4851006 GCAGGCTGACAGGGGCAGGGAGG - Intronic
1143166149 17:4898124-4898146 TGGGGAAGAAAGGGGCAGGGTGG + Exonic
1143176859 17:4960392-4960414 GGGGCATGAAAGGGCCAGCGGGG - Intronic
1143178155 17:4968274-4968296 GGGGTAAGACAGGGCCAGAGAGG + Exonic
1143450812 17:7035910-7035932 GCGGAACGAGAAGGGCAGGGCGG - Intergenic
1143513434 17:7407980-7408002 GTGGAGCGAGAGGGGCAGGGAGG - Intronic
1143542978 17:7580533-7580555 GGGGAATGAGAGAAGCAGGTGGG - Exonic
1143907493 17:10220928-10220950 GGGAAATGACCAGGGCATGGTGG + Intergenic
1144704825 17:17361577-17361599 AGGGGAGGACAGAGGCAGGGAGG + Intergenic
1144704833 17:17361598-17361620 GGGGGAGGACAGAGGTAGGGAGG + Intergenic
1144704841 17:17361619-17361641 GGGGGAGGACAGAGGCAGGGAGG + Intergenic
1144738490 17:17568206-17568228 GAGGAGTCATAGGGGCAGGGTGG - Intronic
1144875267 17:18394205-18394227 GGGGGAGGACAGGGGCAGGTGGG - Intergenic
1144879034 17:18421495-18421517 GGGGCAGGAGAGGGGCAGAGAGG - Intergenic
1145153203 17:20522899-20522921 GGGGCAGGAGAGGGGCAGAGAGG + Intergenic
1145156957 17:20550216-20550238 GGGGGAGGACAGGGGCAGGTGGG + Intergenic
1146367259 17:32238783-32238805 AGGGAATGAGAGAGGGAGGGAGG - Intronic
1146441283 17:32897296-32897318 GGGGGATGAGAGGGAGAGGGAGG - Intergenic
1146844477 17:36174303-36174325 GGGGGAGAACAGGGGCAGGTGGG + Intronic
1146856781 17:36262238-36262260 GGGGGAGAACAGGGGCAGGTGGG + Intronic
1146863836 17:36326137-36326159 GGGGGAGAACAGGGGCAGGTGGG - Intronic
1146872692 17:36386148-36386170 GGGGGAGAACAGGGGCAGGTGGG + Intronic
1146880050 17:36437234-36437256 GGGGGAGAACAGGGGCAGGTGGG + Intronic
1147066695 17:37926725-37926747 GGGGGAGAACAGGGGCAGGTGGG - Intronic
1147075576 17:37986773-37986795 GGGGGAGAACAGGGGCAGGTGGG + Intronic
1147078227 17:38006286-38006308 GGGGGAGAACAGGGGCAGGTGGG - Intronic
1147087101 17:38066319-38066341 GGGGGAGAACAGGGGCAGGTGGG + Intronic
1147094165 17:38130221-38130243 GGGGGAGAACAGGGGCAGGTGGG - Intergenic
1147103046 17:38190282-38190304 GGGGGAGAACAGGGGCAGGTGGG + Intergenic
1147418932 17:40312429-40312451 AGGAAATGAGGGGGGCAGGGAGG - Intronic
1147458547 17:40553960-40553982 GGGAAATGTCAGGGGCGGGGAGG - Exonic
1147571387 17:41573241-41573263 AGGGAATGGGAGAGGCAGGGAGG - Intergenic
1147702406 17:42404322-42404344 GCGGAATGACAGCAGCTGGGTGG + Exonic
1147810815 17:43168929-43168951 GGGAAAGGCTAGGGGCAGGGAGG - Intergenic
1147931178 17:43982589-43982611 GGGGACTAGCAGGGGCTGGGGGG + Intronic
1147957694 17:44146019-44146041 GGGGGCTGCCGGGGGCAGGGAGG - Intronic
1147977722 17:44257621-44257643 GGGACATGACAGGGTCAGTGGGG + Intronic
1148080634 17:44966262-44966284 GGGCAGAGACAGGGGCAGGCAGG - Intronic
1148217124 17:45839463-45839485 GGGGATTGGAAGGGGCAGTGGGG - Intergenic
1148638257 17:49165623-49165645 GGGGAAAGAGAGAGGAAGGGTGG - Intronic
1148647946 17:49230086-49230108 GGGCAGGGGCAGGGGCAGGGAGG + Intronic
1148890802 17:50805828-50805850 GGGGAATGACATGGGGTGGGGGG + Intergenic
1148985038 17:51613502-51613524 GGGGAGAGAGAGGGGCAGAGGGG - Intergenic
1149654172 17:58301645-58301667 GGAGCACGACGGGGGCAGGGTGG + Intronic
1149847621 17:60016748-60016770 GGGGGAGAACAGGGGCAGGTGGG + Intergenic
1149895110 17:60423004-60423026 GGGAAAGGCCAGGGGGAGGGAGG - Intronic
1149993197 17:61394113-61394135 GGGGAAGGGCCGGGCCAGGGAGG - Intergenic
1150085978 17:62273365-62273387 GGGGGAGAACAGGGGCAGGTGGG + Intronic
1151206685 17:72513118-72513140 GGGCAGTGAGAGGGACAGGGTGG + Intergenic
1151356083 17:73559486-73559508 GGAGAATGAGAGGGGCAGATGGG + Intronic
1151365545 17:73614073-73614095 GGGGAAGGGCAGGGGCCGGCAGG - Intronic
1151392263 17:73795424-73795446 GGGAAATGGAAGGGGCAGTGAGG + Intergenic
1151463907 17:74272446-74272468 GGGTCCTGACAGGGGCTGGGTGG - Intergenic
1151766292 17:76135132-76135154 GGGCAATGTCTGGGGCAGGCAGG - Intergenic
1152019475 17:77772907-77772929 GGGAAGTGAGGGGGGCAGGGTGG - Intergenic
1152294010 17:79456293-79456315 GGGGACAGACAGGGTCAGAGTGG - Intronic
1152431737 17:80252049-80252071 CGGGAGGGACAGGAGCAGGGTGG + Intronic
1152521240 17:80858150-80858172 GGGGAAGGCCAGGGACAGGACGG - Intronic
1152800129 17:82327076-82327098 GGGGCATGACAGGGGCAGGAGGG - Intronic
1153864054 18:9246428-9246450 AGGGAAGGAGAGGTGCAGGGAGG - Intronic
1153978566 18:10290498-10290520 GTGGAAGAACAGGGGGAGGGAGG + Intergenic
1154175717 18:12086546-12086568 GGGCTAAGACAGGGCCAGGGTGG - Intergenic
1154212119 18:12388674-12388696 AGGGATTGCCAGGGGCTGGGGGG + Intergenic
1154415719 18:14174284-14174306 GGGCCAAGACAGGGCCAGGGTGG + Intergenic
1155972662 18:32095996-32096018 GGGGAATGCCAGAGTCAAGGAGG + Intronic
1156500972 18:37558152-37558174 GGGGAATTAGTGGGGCATGGTGG - Intronic
1156506671 18:37600182-37600204 GGGGAATTGCGGTGGCAGGGCGG + Intergenic
1156843770 18:41639203-41639225 GGGGAATGGGAGGGGAGGGGAGG + Intergenic
1157190215 18:45575284-45575306 GGAGAAAGACAGGGGCATGGAGG - Intronic
1157852983 18:51074995-51075017 AAGCAATGACAGGGGCATGGTGG - Intronic
1157965568 18:52204740-52204762 AGGGAAGGACAGGGGAGGGGAGG + Intergenic
1158500404 18:57995744-57995766 GAGGAAGGACAGGAGGAGGGAGG + Intergenic
1159241412 18:65748486-65748508 GGGGAATGTCTGCGGCAGGAAGG - Intergenic
1159414041 18:68120592-68120614 GGGCAGTGACGGGGGCAGTGTGG + Intergenic
1159417152 18:68167691-68167713 GGGGATTGTCAGGAGGAGGGGGG - Intergenic
1159452616 18:68621573-68621595 GGGGCCTGTCAGGGGCTGGGAGG + Intergenic
1159467486 18:68803610-68803632 TGGGAATGAGCGAGGCAGGGAGG + Intronic
1159516967 18:69470600-69470622 TGGGGAAGAAAGGGGCAGGGTGG - Intronic
1160511666 18:79456511-79456533 GGAGGAGGAGAGGGGCAGGGTGG - Intronic
1160583641 18:79901193-79901215 GGGGAATGACGGGGGATAGGAGG + Intergenic
1160585595 18:79911763-79911785 GGGAAGGGACAGGAGCAGGGAGG + Intronic
1160893082 19:1389674-1389696 GGGGGATGGCAGGGGCTGCGTGG - Intronic
1160907176 19:1456827-1456849 GGGGGAGGGCAGGGTCAGGGTGG - Intronic
1160975443 19:1790329-1790351 GGGGAAGGATGGGGGCAGTGGGG - Intronic
1161010219 19:1956195-1956217 GGGGGATGCCAGGAGCAGTGGGG + Intronic
1161089026 19:2351163-2351185 GGGCAAGGAGAGGGACAGGGAGG - Intronic
1161103614 19:2433064-2433086 CTGGAATGACCGGGGCATGGGGG - Intronic
1161103683 19:2433274-2433296 CCGGAATGACCGGGGCATGGGGG - Intronic
1161103717 19:2433379-2433401 CCGGAATGACTGGGGCATGGGGG - Intronic
1161103751 19:2433484-2433506 CCGGAATGACCGGGGCATGGGGG - Intronic
1161103786 19:2433589-2433611 CCGGAATGACCGGGGCATGGGGG - Intronic
1161103821 19:2433694-2433716 CCGGAATGACCGGGGCATGGGGG - Intronic
1161139364 19:2638497-2638519 GGGGAATGGAAGGGGAGGGGAGG + Intronic
1161273639 19:3404011-3404033 GGGGCAGGCCAGGGGCTGGGGGG - Intronic
1161349609 19:3784598-3784620 GGGGAAAGAAAGGGGGAGTGGGG + Intronic
1161726367 19:5931552-5931574 GGGGAATCACAGGTGCTTGGCGG + Intronic
1162181488 19:8871999-8872021 GGGCAGTGACAGGGGAAGAGTGG - Intronic
1162450804 19:10753389-10753411 GGGGAAGGGAAGGGGGAGGGGGG - Intronic
1162588745 19:11577349-11577371 GGGCTGTGACAAGGGCAGGGAGG + Intronic
1162740609 19:12771515-12771537 GGAGAAGGACGGGGGGAGGGAGG + Intronic
1162806649 19:13140731-13140753 GGTGAATGGCAGGGCAAGGGGGG - Exonic
1162917725 19:13883237-13883259 GGGGACTCAGAGGAGCAGGGAGG - Intronic
1163003769 19:14384617-14384639 GGGGAAGGGCAGGGGAACGGAGG - Intronic
1163122734 19:15227720-15227742 GGAGATTTGCAGGGGCAGGGGGG - Intronic
1163206047 19:15803458-15803480 GGGAAAGGAAAGGGGGAGGGAGG + Intergenic
1164117155 19:22233782-22233804 GGGCAATGACAGGGGTAGCTGGG + Intergenic
1164717623 19:30405035-30405057 GGGGAATGTATGGGGCATGGTGG + Intronic
1164766651 19:30777491-30777513 GGGGAAAGAAAAGGGCCGGGAGG + Intergenic
1165153255 19:33773086-33773108 GGTGAGTGACCGGGGCAGGGCGG - Exonic
1165306691 19:35007030-35007052 GAGGAAGGACAGGGAGAGGGAGG + Intronic
1165948522 19:39459364-39459386 GGTGGATGGCAGGGGTAGGGAGG + Intronic
1166057896 19:40304305-40304327 GGGGAACAGCAAGGGCAGGGAGG + Intergenic
1166186839 19:41145285-41145307 GGGGACTCAGAGGGGAAGGGTGG - Intergenic
1166384866 19:42375365-42375387 GGGAAGTGACTGGGGCAGTGGGG + Intronic
1166556123 19:43700826-43700848 GGGCTATGACAGTGGGAGGGAGG + Intergenic
1166773397 19:45297965-45297987 CGGGGATGGCAGGGGCAGGGCGG + Intronic
1166774290 19:45302987-45303009 GGGACAGGGCAGGGGCAGGGAGG + Exonic
1166893784 19:46010452-46010474 GGAGAACGTCAGGGGCAGGTAGG + Intronic
1167149259 19:47699414-47699436 GGGGAGTGAGAGGGGAGGGGAGG + Intronic
1167168188 19:47813598-47813620 GGGGAGACAGAGGGGCAGGGTGG - Intronic
1167348938 19:48963195-48963217 GGGGGGGGACAGAGGCAGGGAGG - Intergenic
1167485204 19:49758679-49758701 GGGGAGAGACTGAGGCAGGGAGG - Intronic
1167517653 19:49932659-49932681 GGGGAGGGACAGGGGGAGGGAGG - Exonic
1168184849 19:54693654-54693676 GGGGACTGTCTGGGGCTGGGGGG - Intronic
1168348085 19:55660502-55660524 GGGGAACGACTGGGGGAGGTGGG - Exonic
1168408689 19:56124727-56124749 GGGGGGTGCCAGGGGCTGGGGGG + Intergenic
1168465278 19:56596483-56596505 TGGGAGTGACAGGGGCCGGGTGG + Intronic
1168479353 19:56705793-56705815 TGGGAAGGATAGGGGGAGGGAGG + Intergenic
1168526185 19:57090452-57090474 TGGGGAGGACGGGGGCAGGGCGG + Intergenic
1168565433 19:57418532-57418554 GGGGAAAGACAGGGAAAGGGAGG - Intronic
1168589082 19:57617834-57617856 GGGGAATAATAGGGTCAGGCAGG + Intronic
1202703204 1_KI270713v1_random:3508-3530 GGGGGTGGAGAGGGGCAGGGTGG + Intergenic
925085076 2:1101325-1101347 GGGGAGAGGCAGGTGCAGGGAGG - Intronic
925100340 2:1238865-1238887 TGGGCAGGGCAGGGGCAGGGCGG - Intronic
925170030 2:1744591-1744613 GGGGATTCAGAGGGGCCGGGAGG - Intronic
925203141 2:1985115-1985137 GAGGAGTGACTGTGGCAGGGAGG - Intronic
925233020 2:2252642-2252664 GGGGGAAGACAGCAGCAGGGAGG + Intronic
925349239 2:3189555-3189577 CGGGCAGGAGAGGGGCAGGGAGG + Intronic
925448015 2:3944259-3944281 GGGAAATGGCAAGGACAGGGAGG - Intergenic
925910265 2:8569322-8569344 AGGGAAGGAGAGGGGCCGGGAGG + Intergenic
926025344 2:9537963-9537985 GGGGAAGGGAAGGGGAAGGGAGG + Intronic
926337466 2:11875172-11875194 GGGGAAGGGCAGGGGCGGAGGGG - Intergenic
926697403 2:15780416-15780438 GGGAACTGACAGGGGCTGGTCGG - Intergenic
927356958 2:22185786-22185808 GGGGCATGTCAGGGGTTGGGGGG - Intergenic
928189672 2:29151940-29151962 GGGGAGCGGCAGGGGCAGGGGGG - Intronic
928372666 2:30752398-30752420 AGGGAATGAGAGGGACAGGGAGG + Intronic
928632741 2:33210720-33210742 GGGTAAAGACAGGGGAAGGCAGG - Intronic
928903295 2:36344470-36344492 AGGGAATGAGAGAGGGAGGGAGG + Intergenic
929033676 2:37671715-37671737 GGGGACTCACTGGGGCGGGGCGG + Exonic
929270946 2:39971015-39971037 GTGGCATGGCAGGGGCAGGCTGG - Intergenic
929353556 2:40991165-40991187 GGGGCCTGTCAGGGGCTGGGGGG + Intergenic
929444609 2:41992229-41992251 AGGGAAAGAGAGGGGAAGGGAGG + Intergenic
929560085 2:42951073-42951095 GGGGAACCCCTGGGGCAGGGTGG + Intergenic
929564362 2:42975361-42975383 CGGGAGTGACTGGAGCAGGGAGG - Intergenic
929589299 2:43134684-43134706 GGGGAAGGAGCGGGGCCGGGCGG - Intergenic
929779693 2:44949703-44949725 CGGGACTGACAGGGCCACGGAGG - Intergenic
929920427 2:46167624-46167646 GGGGAGTGCCAAGGGGAGGGAGG + Intronic
930021793 2:47006136-47006158 GGGGAATGACAGGTGGAGAAGGG - Intronic
931119064 2:59196348-59196370 GGGAAGTGACAGTGGCAGTGGGG + Intergenic
932172526 2:69570348-69570370 GGTGACTGGCAGGGACAGGGAGG - Intronic
933498789 2:83086155-83086177 GGGGAGGGACAGAGGGAGGGAGG - Intergenic
934521630 2:95023732-95023754 GGGGAAGGAGAGGGGCAGATGGG + Intergenic
935789863 2:106580988-106581010 AGGTGATGACAGGGGCAGGAAGG + Intergenic
936462263 2:112722336-112722358 GGGGGAGGACAGAGGGAGGGAGG + Intronic
936826986 2:116593774-116593796 GGTGATTGACAGGAGCTGGGTGG - Intergenic
936973999 2:118201588-118201610 GTGGAGTGACAGTGGCTGGGAGG + Intergenic
937060394 2:118976519-118976541 GGGCAGGGGCAGGGGCAGGGAGG - Intronic
937084873 2:119164852-119164874 AGGGAATGAGAGAGGGAGGGAGG - Intergenic
937307472 2:120881353-120881375 GGAGAAGGACAGTGGCAGGGAGG + Intronic
937307535 2:120881542-120881564 GGGGAAAGACAGTGGTGGGGAGG + Intronic
937513790 2:122629407-122629429 GAGGAATGTCAGGGTAAGGGGGG + Intergenic
937825381 2:126363542-126363564 GGAGCATGGCAGAGGCAGGGAGG - Intergenic
937885921 2:126899905-126899927 GGGGAGGGACAGGGGCTAGGGGG - Intronic
938119966 2:128626370-128626392 GAACAGTGACAGGGGCAGGGAGG - Intergenic
938292047 2:130155581-130155603 GGGGAATGCCTTGGGCAAGGAGG + Intronic
938464503 2:131517386-131517408 GGGGAATGCCTTGGGCAAGGAGG - Intergenic
938940147 2:136162535-136162557 AGGGAGGGAGAGGGGCAGGGAGG + Intergenic
938950705 2:136251921-136251943 AGGGAATGACAGTGGCAGGCTGG + Intergenic
939190651 2:138913055-138913077 GGGGCATGTCAGGGGGTGGGGGG + Intergenic
939634135 2:144560526-144560548 AGGGAAGGAGAGGGGAAGGGAGG - Intergenic
939992375 2:148887937-148887959 GGGTAGTGATAGGGGCGGGGAGG - Intronic
940660998 2:156544905-156544927 GAGGAGTGACGGGGTCAGGGAGG - Intronic
941590225 2:167410572-167410594 GGGGCCTGTCAGGGGCTGGGGGG + Intergenic
941918031 2:170824606-170824628 GGGGAAGGGCAGGGGGAGAGTGG - Intronic
942202111 2:173581805-173581827 GGGGAAGGGCTGGGGGAGGGAGG - Intergenic
942331294 2:174827604-174827626 GGGGAGTGACACGGTCAAGGGGG + Intronic
944154847 2:196598180-196598202 GGGGAAAGAGAGGGGAAGGGGGG + Intergenic
944154855 2:196598199-196598221 GGGGAAGGGAAGGGGAAGGGAGG + Intergenic
944154895 2:196598280-196598302 GGGGAAGGGAAGGGGAAGGGAGG + Intergenic
944291074 2:198005762-198005784 GGCTGGTGACAGGGGCAGGGAGG + Intronic
944897638 2:204181361-204181383 GGATAATGACAGGCCCAGGGAGG + Intergenic
946156177 2:217808214-217808236 GGGGAATGAGGGGGGAATGGGGG - Intronic
946158676 2:217822933-217822955 TGGGTAAGACAGGGACAGGGTGG - Intronic
946226166 2:218265182-218265204 GAGGAATGACAGAGGCAGGGCGG + Intronic
947354710 2:229280098-229280120 GGGGAATCCCAGGGGGCGGGTGG + Intergenic
947854105 2:233311660-233311682 CAGGAAGGACAGGGGCAGGATGG - Intronic
948178484 2:235961983-235962005 GGGGACAGGCTGGGGCAGGGCGG + Intronic
948424440 2:237878283-237878305 GGGGAGGGCCAGGGGCAGGGAGG + Intronic
948453375 2:238092611-238092633 GGAGAAGGTCAGGGGCTGGGGGG - Intronic
948458386 2:238117814-238117836 GAGGAATGAATGGGGCAGGGAGG + Intronic
948480054 2:238243547-238243569 TGCGAATGATATGGGCAGGGCGG - Intergenic
948525805 2:238570151-238570173 TGGGAATGGCAGGGACAGTGGGG + Intergenic
948577841 2:238965626-238965648 GGACAAAGACAGGAGCAGGGAGG - Intergenic
948641410 2:239378090-239378112 GGGGAATGCCAGCGGCAGGTGGG + Intronic
948689884 2:239695309-239695331 GGGGCAGGACAGGGCCAGAGAGG - Intergenic
948730363 2:239959689-239959711 AGGGAAGGAAAGAGGCAGGGAGG + Exonic
948730375 2:239959746-239959768 AGGGAAGGAAAGAGGCAGGGAGG + Exonic
948838555 2:240637825-240637847 GGGCACAGACAGGGGCAGGGTGG - Intergenic
948845336 2:240680331-240680353 AGGTAAGGGCAGGGGCAGGGTGG - Exonic
948848525 2:240694548-240694570 AGGTAAGGGCAGGGGCAGGGTGG + Exonic
948855261 2:240727356-240727378 GAGGAAGGACAGAGGCAGGGAGG + Intronic
1168821444 20:776039-776061 GGGGAAAGGCAGGCGGAGGGTGG + Intergenic
1168849533 20:967135-967157 GGGGAGGGGCAGGGGCAGGGCGG + Intronic
1168860691 20:1044169-1044191 TGGGAAGGATCGGGGCAGGGTGG + Intergenic
1168907445 20:1417604-1417626 AGGGAATGACAGGCACAGTGTGG + Intergenic
1168977009 20:1974362-1974384 TGCAAGTGACAGGGGCAGGGAGG - Intergenic
1168989133 20:2079360-2079382 GGAGAATGACAGCGGGAAGGAGG - Intergenic
1169130739 20:3165375-3165397 GGGGGATGAAAGGAGCAGGGGGG - Intronic
1169217022 20:3800006-3800028 GGGGCAGGTCAGGGTCAGGGAGG - Intronic
1169288325 20:4328131-4328153 GGGGAATGGAGGCGGCAGGGTGG - Intergenic
1169432090 20:5545583-5545605 GGCCAATGACAGGGACAGGGTGG + Exonic
1169940604 20:10933299-10933321 GGGGCCTGCCAGGGGCGGGGTGG + Intergenic
1170594040 20:17792267-17792289 GGGGAAGGACATGGGAAAGGAGG + Intergenic
1170676290 20:18484064-18484086 GGGGTATGACTGGGGGAGAGTGG + Exonic
1170979326 20:21196248-21196270 GGGAAATGACAGGGTAAGAGTGG - Intronic
1171469996 20:25362609-25362631 AGGGAAGGACAGGGGAGGGGAGG + Intronic
1171794747 20:29558076-29558098 AGGGAATGACAGTGCCAAGGAGG - Intergenic
1171853709 20:30326189-30326211 AGGGAATGACAGTGCCAAGGAGG + Intergenic
1172291618 20:33781063-33781085 GAGGCAAGGCAGGGGCAGGGTGG + Intronic
1172653441 20:36522085-36522107 GGAGAATGACAGAGGTGGGGAGG - Intronic
1173239441 20:41280829-41280851 GGGAAATGAGAGGGGAAAGGAGG + Intronic
1173305151 20:41841114-41841136 AGGGAAGGACAGAGGGAGGGAGG - Intergenic
1173577687 20:44123609-44123631 GCGGAATGACTGTGGCTGGGAGG + Intronic
1173615486 20:44400637-44400659 GGAGACGGAGAGGGGCAGGGTGG + Intronic
1173677635 20:44851230-44851252 GGGGGTTGCCAGGGGCTGGGTGG + Intergenic
1173835683 20:46123734-46123756 GGGGAGAGACAGAGGCAGGGAGG - Intronic
1173869071 20:46330487-46330509 GGGGAATTCCACGGGGAGGGTGG + Intergenic
1173989814 20:47293233-47293255 AGGGAAGGACAGAGGGAGGGAGG + Intronic
1174311389 20:49657902-49657924 TGGGAATGACAGAGGTGGGGTGG + Intronic
1174406531 20:50306585-50306607 GGGCCAGGACAGAGGCAGGGGGG + Intergenic
1174523765 20:51155238-51155260 GAGCAATGACAGGGGAAAGGAGG + Intergenic
1174721074 20:52813016-52813038 GGTGAATGACTGGGGCATGAGGG - Intergenic
1175130109 20:56782419-56782441 GGGAAAGGAAAGAGGCAGGGAGG + Intergenic
1175196006 20:57243794-57243816 GGGAAATGAAAGGGGCTGAGAGG - Intronic
1175229679 20:57465813-57465835 GAGGAATGAGAGGATCAGGGTGG - Intergenic
1175260306 20:57670069-57670091 TGGGAATGGGTGGGGCAGGGAGG + Intronic
1175336235 20:58198193-58198215 GGTGAATGACAGGAGCGGGCTGG + Intergenic
1175524817 20:59626368-59626390 GAGGAATGAGACTGGCAGGGAGG + Intronic
1175757046 20:61536454-61536476 GGGGAGGGAGTGGGGCAGGGAGG + Intronic
1176015913 20:62932160-62932182 TTGGAATGAAAGAGGCAGGGTGG - Intronic
1176036884 20:63043938-63043960 CGGGAATGTCAGGGGAACGGGGG + Intergenic
1176086240 20:63296836-63296858 GGGGAAGAGCAGGGGCTGGGGGG - Intronic
1176098877 20:63356139-63356161 GGGGCGGGACAGGGCCAGGGTGG + Intronic
1176098909 20:63356215-63356237 GGGGCGGGACAGGGCCAGGGTGG + Intronic
1176169023 20:63688839-63688861 GGGGAACCCCAGGGCCAGGGTGG - Intronic
1176409001 21:6437602-6437624 GGGGGAGGACACTGGCAGGGAGG - Intergenic
1176857620 21:13985020-13985042 GGGCCAAGACAGGGCCAGGGTGG - Intergenic
1176866988 21:14059207-14059229 GGGCCAAGACAGGGCCAGGGTGG + Intergenic
1177233838 21:18360107-18360129 GGTGATTGCCAGGGGCTGGGAGG - Intronic
1178424554 21:32468981-32469003 AGGGAAAGTCAAGGGCAGGGAGG + Intronic
1178630248 21:34253276-34253298 GGGGAAGGGCAGGGGCATGTTGG + Intergenic
1178954592 21:37010815-37010837 GAGGACTGACAGGTGCAGAGAGG - Intronic
1179399400 21:41070083-41070105 GGAGAATAACATGGGGAGGGAGG - Intergenic
1179684494 21:43045924-43045946 GGGGGAGGACACTGGCAGGGAGG - Intergenic
1179922288 21:44513756-44513778 TGGGAATGCCAGGGGAGGGGAGG + Intronic
1179933544 21:44588988-44589010 GGGGACTGAGAGGGAAAGGGCGG + Intronic
1179999520 21:44989062-44989084 AGGGCAGGGCAGGGGCAGGGAGG - Intergenic
1180055468 21:45356810-45356832 TGGGAGAGACAGGAGCAGGGAGG - Intergenic
1180147715 21:45930526-45930548 CAGGCATGCCAGGGGCAGGGTGG - Intronic
1180198649 21:46212069-46212091 GGGGACAGGGAGGGGCAGGGAGG + Intronic
1180700823 22:17780718-17780740 GGAGAAAGACAGGAGCAGAGGGG + Intergenic
1180742761 22:18065223-18065245 GGGCCAGGACAGTGGCAGGGTGG + Intergenic
1181171316 22:21011757-21011779 GGGGGAGGTCAGGGGCAGAGGGG - Intronic
1181178035 22:21048771-21048793 GGGGGAGGTCAGGGGCAGAGGGG + Intronic
1181774050 22:25147044-25147066 GGGAAATGAGAGAGGGAGGGAGG + Intronic
1182010138 22:26993953-26993975 GGGAAATGCCAGGGCCACGGAGG - Intergenic
1182234261 22:28863284-28863306 GGGGGCTGGCAGGGGTAGGGTGG - Intergenic
1182417259 22:30229361-30229383 GGGTGAGGAAAGGGGCAGGGAGG - Intergenic
1182921184 22:34081026-34081048 GGGGCCTGACAGGGGGTGGGGGG - Intergenic
1183193459 22:36336616-36336638 TGGGAAAGCCAGGGGCAGGAGGG + Intronic
1183247088 22:36702308-36702330 GGGGAGTGAAAGGGGAGGGGTGG + Intronic
1183700654 22:39449175-39449197 GGGGGAACACAGGGGCAGCGGGG - Intergenic
1183859879 22:40662189-40662211 GGAGAATGACAGGGGTAGCTAGG - Intergenic
1184177382 22:42795915-42795937 GGGGAAGGGGAGGGGCAGTGGGG + Intergenic
1184533344 22:45070738-45070760 GGGGAGAGCCTGGGGCAGGGGGG - Intergenic
1184698104 22:46150746-46150768 GGGGAGGGGCAGGGGCTGGGCGG + Intronic
1184920201 22:47600609-47600631 GGGGGATGTCAGAGGCTGGGAGG - Intergenic
1185209858 22:49564773-49564795 GGGCAGTGACAGGGCGAGGGGGG - Intronic
1185223165 22:49639339-49639361 AGGAAATGACAGGGGTAGAGAGG - Intronic
1185296915 22:50058906-50058928 GGGAAACGACAGGGGCCGTGTGG - Intergenic
1185337565 22:50277556-50277578 GGGGCAGGTCTGGGGCAGGGAGG - Intronic
1185389205 22:50549731-50549753 GGGGGCGGGCAGGGGCAGGGAGG - Exonic
949240514 3:1865672-1865694 GGGGTCTGTCAGGGGCTGGGGGG + Intergenic
949358025 3:3202313-3202335 GGGGAAGGACAGGAGGAGAGAGG + Intergenic
949879832 3:8652515-8652537 GAGGAAAGAAAGGGGAAGGGTGG + Intronic
950138828 3:10601392-10601414 GAGGAATAACACGGGGAGGGAGG + Intronic
950892267 3:16414656-16414678 GGTGAATGGCAGGGGCAGCAGGG + Intronic
951003668 3:17593277-17593299 GGGTGATGACAGGGGCAGCTGGG - Intronic
951728122 3:25782866-25782888 GGGGAATGACACGCGCGGTGCGG + Intronic
951798305 3:26566706-26566728 GGGGAGGGCCAGGAGCAGGGAGG - Intergenic
952258895 3:31720360-31720382 GGGCAATGGCAGGGGCAGCCTGG + Intronic
952724333 3:36567492-36567514 GGGGCCTGTCAGGGGCTGGGGGG - Intergenic
952920695 3:38282120-38282142 GCACAAAGACAGGGGCAGGGGGG + Intergenic
953025482 3:39142533-39142555 GGGTAATGCCAGGGGTGGGGTGG - Exonic
953492691 3:43364291-43364313 AGGGACGGACAGGGGCAGGTAGG - Intronic
953553536 3:43923902-43923924 AGAGAATGAAAGGGGAAGGGGGG - Intergenic
953695564 3:45155731-45155753 GGTGGATGACAGGGGCTGGAGGG - Intergenic
953800605 3:46019823-46019845 GGGGAAAGAGAGGAGCAGTGGGG + Exonic
953880145 3:46687213-46687235 GGGGATTAGCTGGGGCAGGGAGG - Intronic
954257546 3:49417122-49417144 GGGTAATAACATGGGCAGTGCGG - Exonic
954298626 3:49687527-49687549 GGGGGTGGAGAGGGGCAGGGTGG - Intronic
954372100 3:50174362-50174384 GGGGCAGCACAGGGCCAGGGTGG - Intronic
954415199 3:50389999-50390021 GGGGGCTGTCAGGGTCAGGGTGG + Intronic
954585993 3:51737342-51737364 AGGGCCTGTCAGGGGCAGGGGGG - Intergenic
954638674 3:52085306-52085328 GGGGACTGAGAGGAGCAGGCCGG - Intronic
954784891 3:53085334-53085356 AGGGGATGCCAGGAGCAGGGAGG - Intronic
954992933 3:54856469-54856491 AGGGAAGGACAGGAGCAGGTGGG - Intronic
955029568 3:55203316-55203338 GTGGAAACAGAGGGGCAGGGTGG + Intergenic
955320677 3:57972170-57972192 GGGTAAAGTCAGGGGCAGGGAGG + Intergenic
955494866 3:59520684-59520706 GGGGAATGGGAGAGGAAGGGTGG - Intergenic
955833660 3:63030457-63030479 GGGGAGGGAGAGGGGCAGGGGGG + Intergenic
955959679 3:64327449-64327471 GGGGAATGGAACAGGCAGGGAGG + Intronic
955990704 3:64624047-64624069 GGTAAATGCCAGGGGCAGGAGGG + Intronic
956012354 3:64845148-64845170 GGGGAATGACGTGGTCAGGTTGG - Intergenic
956269967 3:67441215-67441237 GGGGCCTGTCAGGGGCTGGGGGG + Intronic
956724201 3:72143890-72143912 AGGGAATGAGAGGGGGAAGGAGG - Intergenic
956768591 3:72505494-72505516 AGGGCATGGCAGGGACAGGGTGG + Intergenic
956937231 3:74116981-74117003 GGGGAATGACTGGTGAAAGGTGG - Intergenic
956991503 3:74771716-74771738 GGGGAATGGATGGGGAAGGGAGG + Intergenic
959672916 3:108999329-108999351 TGGGAATAATGGGGGCAGGGAGG + Intronic
959997969 3:112699110-112699132 GGGCAATGACAGGGGCGGCTGGG - Intergenic
960637269 3:119796029-119796051 GGGGAAAGTGAGAGGCAGGGAGG - Intronic
961073523 3:123961090-123961112 GGGGATGGAGAGGGACAGGGGGG - Intronic
961310045 3:125990730-125990752 GGGGATGGAGAGGGACAGGGGGG + Intergenic
961390777 3:126551249-126551271 AGTTAATGTCAGGGGCAGGGGGG - Intronic
961612604 3:128152960-128152982 GGGGGAAGACGGGGGCGGGGGGG - Intronic
961831019 3:129623105-129623127 GGGCAAGGACAGGAGGAGGGTGG - Intergenic
962404116 3:135085720-135085742 TGGGAAAGACAGAGGCAAGGAGG - Intronic
962711990 3:138095125-138095147 GGGGAAACAGAGGGACAGGGAGG - Intronic
962947756 3:140187361-140187383 GGGGTATGTCAGGATCAGGGTGG - Intronic
964531170 3:157669458-157669480 GGGACATGACTGGGGCAAGGTGG - Intronic
965406500 3:168275854-168275876 GGGCAATCACAGGCGCTGGGTGG + Intergenic
965677541 3:171213513-171213535 TGGGAAAGACAGGGGAGGGGGGG + Intronic
966559201 3:181300110-181300132 GGGGAAGGAGAAGGGGAGGGAGG + Intergenic
966787796 3:183636293-183636315 GAGGAATGACGGGGTCAAGGTGG + Exonic
966883600 3:184362723-184362745 GGGTAATGCCCGGGGGAGGGGGG + Intronic
967078453 3:186026462-186026484 GAGGAATGACAGGGGGCTGGGGG - Intergenic
967323000 3:188212642-188212664 GGGGAAGGGTGGGGGCAGGGTGG - Intronic
967323006 3:188212653-188212675 GAGGAATGAAGGGGGAAGGGTGG - Intronic
967954711 3:194869288-194869310 GGGGAAGGAAAGGGGAGGGGAGG + Intergenic
967989356 3:195119913-195119935 GGGGGAGGTCAGGGGCTGGGCGG + Intronic
968610684 4:1555596-1555618 GCGAAAGGACAGGGACAGGGAGG - Intergenic
968621013 4:1603501-1603523 GGGGCAGCTCAGGGGCAGGGTGG + Intergenic
968954842 4:3712984-3713006 GGGGACTGGCCGGGGCAGAGGGG - Intergenic
969291500 4:6242946-6242968 GGGGAATGGGAGGGGCATGGAGG - Intergenic
969369269 4:6720907-6720929 AGGGAATGACAGGGACATTGAGG + Intergenic
969436334 4:7191625-7191647 GGGGAAGGCCATGGGCAGGGTGG + Intergenic
969448618 4:7260025-7260047 GGGGAGTGAGAGGGGTATGGTGG - Intronic
969682913 4:8653081-8653103 AGGGAATGAGAAGGGCAGGAGGG - Intergenic
969693946 4:8724525-8724547 CGGGGATGGCAGGGGCAGGTGGG + Intergenic
969721610 4:8895404-8895426 GGGGCAGGGGAGGGGCAGGGAGG + Intergenic
969724739 4:8912338-8912360 GGGGAATGAAGGGAGCAGTGTGG + Intergenic
969833779 4:9821486-9821508 GGGGCCTGTCAGGGGCTGGGGGG + Intronic
970328234 4:14951296-14951318 GGGGACTCACAGGGAAAGGGTGG + Intergenic
970966526 4:21934689-21934711 AGGGAAGGACAGGGGAAGAGTGG - Intronic
972390777 4:38610900-38610922 TGGGAATGACGGGGGTTGGGGGG - Intergenic
972961237 4:44454631-44454653 AGGGGAGGACAGGGGGAGGGAGG + Intergenic
973249634 4:48047608-48047630 GGGTACTGGCAAGGGCAGGGAGG + Intergenic
973652320 4:53008331-53008353 GGGGAGGGAGAGGGGAAGGGGGG - Intronic
973835600 4:54806325-54806347 AGGGAAAGAAAGGGGGAGGGAGG + Intergenic
974995943 4:69158989-69159011 GGGAAAGGATAGGAGCAGGGAGG + Intronic
975577599 4:75878126-75878148 GGGGAAGGACAGGGGAGGGGAGG + Intronic
976403718 4:84637550-84637572 GGGAAGTGACTGGGTCAGGGAGG - Intronic
976449740 4:85174511-85174533 GGGAAATGCCAGGGTCAGTGAGG - Intergenic
977145915 4:93439821-93439843 GGGGCATGCCAGGGGCAGTTGGG + Intronic
978443997 4:108763199-108763221 GAGGAATGATAGGGGCGGGTAGG - Intergenic
980696526 4:136363518-136363540 GGGGCCTGTCAGGGGGAGGGAGG + Intergenic
981037525 4:140187807-140187829 GGGCAATGACAGGCACAGGGGGG + Intergenic
981765328 4:148242021-148242043 GGTGCATGACAGGGGCTGGGGGG + Intronic
982605947 4:157515812-157515834 GGGGAGCGGCAGGGGCAGCGTGG + Intergenic
982633620 4:157864731-157864753 GGGGAATGACAGGGGTGAGAAGG - Intergenic
982834150 4:160102468-160102490 GGTGAATGGCAGGGGCTAGGGGG - Intergenic
983191224 4:164755508-164755530 GGGGGAGGAGAGGGGAAGGGAGG + Intergenic
983556049 4:169060040-169060062 GGGAAATGACAGGCACAGGAAGG - Intergenic
984164194 4:176288159-176288181 GGGGAAGGGAAGGGGAAGGGAGG - Intergenic
984707692 4:182859860-182859882 TGGGAAATACAGGGGGAGGGAGG - Intergenic
984910394 4:184668956-184668978 GCTGAATGAAAAGGGCAGGGTGG - Intronic
985102537 4:186473098-186473120 AGGGAATGACAGGATCAGGCAGG + Intronic
985542164 5:492250-492272 GGGGACTCACAGGGGAGGGGAGG + Intronic
985652254 5:1112493-1112515 GGGGGTTCATAGGGGCAGGGGGG - Intergenic
985894565 5:2740691-2740713 GGGGAAGGACGTGGGCCGGGTGG + Intergenic
986026654 5:3857642-3857664 GGGCAATGACAGAGGCAGGGAGG + Intergenic
986244355 5:5991932-5991954 GTGGCATGGCAGGGGGAGGGGGG + Intergenic
986689581 5:10303174-10303196 CGGGGATGGCAGGGTCAGGGTGG - Intronic
987051965 5:14154339-14154361 GGGGAGTGAGAGGGGCAGGAGGG + Intronic
987080985 5:14425234-14425256 GGGCAGTGCCAGGGGCTGGGAGG - Intronic
987749123 5:22017154-22017176 GGGGAAGGACAGGGAAAGAGAGG - Intronic
988171964 5:27669721-27669743 GGGGACTGTCAGGGGGTGGGGGG - Intergenic
988627461 5:32893005-32893027 GGGGCCTGACAGGGGTCGGGGGG - Intergenic
988667169 5:33341837-33341859 GGGGCCTGTCAGGGGCTGGGGGG - Intergenic
988686535 5:33530602-33530624 GGAGAAAGACAGAGGAAGGGTGG + Intronic
988857891 5:35247003-35247025 GGGGAAGGGGAGGGGAAGGGAGG + Intergenic
988920713 5:35939287-35939309 TGGGAATGACAAGGATAGGGTGG - Intergenic
989189388 5:38655306-38655328 GGGGAAGGAGAGAGGGAGGGAGG - Intergenic
990443754 5:55872767-55872789 GAGCAATGACATTGGCAGGGTGG - Intronic
990754615 5:59055256-59055278 AGGGATTGACAGAGGAAGGGAGG - Intronic
991037953 5:62146669-62146691 GTGGAGGGGCAGGGGCAGGGTGG + Intergenic
991095976 5:62739993-62740015 GGGGAGGGACAAGGGGAGGGAGG - Intergenic
991322110 5:65385130-65385152 TGTGAATTTCAGGGGCAGGGAGG + Intronic
992312135 5:75511632-75511654 GGGAAAGGACAGGGGAGGGGAGG - Intronic
993202341 5:84831534-84831556 GGGGAAAGATGGAGGCAGGGAGG + Intergenic
993926601 5:93873407-93873429 GGGAAAGGAAAGGGGAAGGGAGG + Intronic
994355495 5:98789692-98789714 GGGGGTTGAGAGGGGCTGGGTGG + Intronic
994599674 5:101886993-101887015 GGGAAGTGCCAGGGGCAGTGGGG - Intergenic
994679313 5:102865860-102865882 CCGGAATGACAGGGGCTGTGAGG - Intronic
995262999 5:110127463-110127485 GGGGCCTGTCAGGGGCTGGGGGG - Intergenic
996762314 5:126998766-126998788 GGGGATTGACAGGGAGAGAGTGG - Intronic
997180101 5:131819443-131819465 GAGGAGGGACAGGGGGAGGGAGG + Intronic
997834994 5:137184940-137184962 GGAGAATGACAGGGACAGTGTGG - Intronic
998130042 5:139647261-139647283 GGGGAGGGAGAGGGGGAGGGCGG - Intergenic
998170118 5:139867856-139867878 GGGGGAGTACAGGGGCAGGAGGG + Intronic
998353629 5:141516720-141516742 AGAGAAAGACAGGGTCAGGGTGG + Exonic
998570385 5:143251601-143251623 GGGGAATGGTAGGGACAGGGCGG + Intergenic
998604043 5:143615516-143615538 GGGGGATGGGAGGGGGAGGGAGG - Intergenic
999178832 5:149654399-149654421 GGGGGAGGATAGGGGAAGGGAGG - Intergenic
999265310 5:150263258-150263280 TGGGAATGAGAGGGAGAGGGAGG + Intronic
999378254 5:151101803-151101825 GGGGAGTGACAGGTGGAGAGAGG - Intronic
1000345638 5:160311828-160311850 TGAGAGTGACAAGGGCAGGGAGG + Intronic
1000610586 5:163369253-163369275 TGGGTTTGACAGGGGCAGGGAGG - Intergenic
1000890304 5:166793793-166793815 GGGTCATGACTGGGGCAGGATGG + Intergenic
1001086983 5:168707577-168707599 GGGGTTTGGCAGGGGCATGGTGG + Intronic
1001568527 5:172715501-172715523 AGGGAGTGAGAGGGGCCGGGAGG + Intergenic
1001701199 5:173707677-173707699 GGGAAATGCCTGGGGCAGGGTGG + Intergenic
1001765378 5:174241886-174241908 AGGGAAGGTCAGGGGGAGGGAGG - Intronic
1001824322 5:174733277-174733299 GGGGAATGGAGGGAGCAGGGCGG + Intergenic
1001868334 5:175125681-175125703 GGTGAAGGAGAGGGGAAGGGAGG - Intergenic
1001938710 5:175726157-175726179 TGGGAATGGGAGGGGAAGGGAGG + Intergenic
1001959170 5:175870087-175870109 GGGGGATGGCAGTGGCAGGGAGG - Intronic
1002026012 5:176396792-176396814 GGGCAGTGACATGGGCAGTGGGG - Intronic
1002092436 5:176813209-176813231 GGGAGACCACAGGGGCAGGGTGG - Intronic
1002106221 5:176880600-176880622 GGGGAGGGGCAGGGGCAGGGAGG - Exonic
1002153182 5:177253605-177253627 GGGGGAGGGAAGGGGCAGGGAGG - Intronic
1002599250 5:180344941-180344963 GGTGAATGGCAGCAGCAGGGAGG - Intronic
1002865489 6:1118476-1118498 GATGAATGACAGGGGCAGGTGGG - Intergenic
1002945409 6:1756666-1756688 GCGGACTGACTGGGGCAGTGGGG + Intronic
1004030456 6:11863439-11863461 GGTGGTTGACAGGGGCTGGGAGG - Intergenic
1004289774 6:14355892-14355914 GGGGCCTGTCAGGGGCTGGGGGG - Intergenic
1004349460 6:14878407-14878429 GGGGAAGGGGAGGGGCAGAGGGG + Intergenic
1004562114 6:16760965-16760987 GGGGGCTGTCAGGGGCTGGGTGG - Intronic
1004777024 6:18859017-18859039 GGTGATTGCCAGGGGCTGGGAGG - Intergenic
1004987294 6:21097098-21097120 GGGTATTCAAAGGGGCAGGGAGG + Intronic
1005047337 6:21654583-21654605 AGGCAATGGCCGGGGCAGGGAGG + Intergenic
1005518543 6:26577660-26577682 GGGGAATGACAGGAGCACTCTGG + Intergenic
1005565322 6:27086951-27086973 TGGGAATGACAGACTCAGGGAGG - Intergenic
1005971329 6:30764137-30764159 AGGGGAGGACAGGGGCCGGGGGG + Intergenic
1006012457 6:31054232-31054254 GTGGAAGGAGAAGGGCAGGGTGG + Intergenic
1006378604 6:33685084-33685106 TGGGCATGATGGGGGCAGGGTGG + Intronic
1006410338 6:33870065-33870087 GAGGAAGGAGAGGGGTAGGGAGG + Intergenic
1006466379 6:34197116-34197138 GGGGGCTGAGAGGGGTAGGGGGG - Intergenic
1006738692 6:36292629-36292651 GTGGGGTGACAGGGGCATGGTGG - Intronic
1006823543 6:36917311-36917333 GGGAAATGATGGGGGCAGAGTGG - Intronic
1006833047 6:36980449-36980471 GGGGAATGACAGAAGTAGGAAGG - Intronic
1006905530 6:37530691-37530713 GGATCATGAAAGGGGCAGGGAGG - Intergenic
1006945783 6:37783700-37783722 ATGGAGAGACAGGGGCAGGGAGG - Intergenic
1007077724 6:39078530-39078552 GGGCAGGGGCAGGGGCAGGGAGG - Intronic
1007088665 6:39168188-39168210 GCAGAAAGACAGCGGCAGGGAGG - Intergenic
1007163650 6:39812593-39812615 GAAGGCTGACAGGGGCAGGGTGG - Intronic
1007181891 6:39934501-39934523 GGGGAGGGGCAGGGGGAGGGCGG + Intronic
1007229448 6:40338200-40338222 GGGGAAAGACACCGGCAGAGAGG + Intergenic
1007346017 6:41229846-41229868 GCGGGAGGACAGGGGCAGGAGGG - Intronic
1007957884 6:45933750-45933772 GTGGACAGAGAGGGGCAGGGAGG + Intronic
1008724457 6:54400121-54400143 AAGGAATGCCAGTGGCAGGGAGG + Intergenic
1011182579 6:84637418-84637440 GGGAAATGAGAGGGGCACTGAGG - Intergenic
1011189890 6:84717597-84717619 GGGGGAACACCGGGGCAGGGGGG + Intronic
1011770274 6:90668040-90668062 GCGGAATGACAGGGAAAGAGGGG - Intergenic
1012039802 6:94189609-94189631 GGGGAAGGAGAGGGGAGGGGAGG + Intergenic
1012344688 6:98171113-98171135 GGGCAATGACAGGGGTAGCTGGG - Intergenic
1014068280 6:117151856-117151878 TGGGAATGACTGGGTCATGGGGG - Intergenic
1014666377 6:124242877-124242899 GGGGCATGTCAGGGGCTGGGGGG + Intronic
1014999024 6:128191398-128191420 GGGGCAGGGCAGGGGCAGGGCGG + Intronic
1015205188 6:130629717-130629739 GGGGAGAGAGAGGGGGAGGGAGG + Intergenic
1015519362 6:134115167-134115189 GGGGAAGGACAGGGGCAATGGGG + Intergenic
1015549484 6:134397106-134397128 GGGGGATGACAGTGGCAGAGTGG - Intergenic
1017051473 6:150397871-150397893 GGAGATTGATGGGGGCAGGGAGG + Intronic
1017245842 6:152223639-152223661 AGGGAAGGAGAGGGGAAGGGAGG + Intronic
1017705367 6:157117856-157117878 TGGGAAGAACAGAGGCAGGGGGG - Intronic
1018034777 6:159872795-159872817 GGGGGTTGCCAGGGGCTGGGTGG + Intergenic
1018065700 6:160123876-160123898 GGTGAATGCCATGAGCAGGGCGG + Intronic
1018756072 6:166850786-166850808 GGGAGATGACAGGGACATGGAGG + Intronic
1018798884 6:167207615-167207637 AGGGTAGGAGAGGGGCAGGGAGG + Intergenic
1019437291 7:1028651-1028673 GGGGGACGATAGGGGCTGGGTGG - Intronic
1019479941 7:1261661-1261683 GGAGGATGGCAGGGGCAGGGGGG + Intergenic
1019508262 7:1404489-1404511 GCGGAAGGACAGGGCCTGGGTGG + Intergenic
1019551817 7:1606884-1606906 GGGGAAGAACAGGGGGAGGAGGG - Intergenic
1019618584 7:1978456-1978478 GGGGAAGGAGAGTGGCAGAGGGG - Intronic
1019718064 7:2550699-2550721 GAGAAATGACAGAGGCTGGGAGG + Intronic
1019937527 7:4266131-4266153 GGGGAAGGAGAGGGCCAGCGTGG - Exonic
1019960516 7:4455591-4455613 GGGAGATGACAGAGGAAGGGAGG - Intergenic
1020817213 7:12920499-12920521 GGGGAGGGAGAGAGGCAGGGAGG - Intergenic
1021194401 7:17659248-17659270 TGGCTATGACAGGGGCAGAGTGG - Intergenic
1021423322 7:20470103-20470125 GGGGAGTGACAGGAGCAAGAGGG - Intergenic
1021640209 7:22729140-22729162 GGAGAATGAGCTGGGCAGGGAGG - Intronic
1021855482 7:24850689-24850711 GGCCAATGACAGAGGTAGGGAGG + Intronic
1022503555 7:30897098-30897120 GGGGAGGGAAAGAGGCAGGGAGG - Intergenic
1023170351 7:37385355-37385377 GGGGAATAGCAGGGCCAGTGTGG - Intronic
1023365245 7:39457430-39457452 GGGTAAGGAAAGGGCCAGGGTGG + Intronic
1023840341 7:44093622-44093644 GGGGATTGTCAGGGGCAAGGAGG + Intergenic
1024308280 7:47946294-47946316 GGGGCCTGTCAGGGGCTGGGGGG + Intronic
1024744314 7:52389215-52389237 GGGTGATGACAGGGGCAGCTGGG - Intergenic
1024920282 7:54546737-54546759 GGGGTATGCCAGGGACAGCGTGG + Intronic
1024920288 7:54546758-54546780 GGGGTATGCCAGGGACAGCGTGG + Intronic
1025994333 7:66518632-66518654 GCAGAATGCCAGGGTCAGGGTGG - Intergenic
1026003310 7:66580512-66580534 GGAGAATGATAGGAGCAGAGAGG - Intergenic
1026028229 7:66765150-66765172 GGAGAATGATAGGAGCAGAGAGG + Intronic
1026036366 7:66833068-66833090 GGGGCAAGGCTGGGGCAGGGTGG - Intergenic
1026037441 7:66839980-66840002 GGGGCAAGGCTGGGGCAGGGTGG - Intergenic
1026124828 7:67570373-67570395 GGGGATTGACAGTGGGAAGGGGG + Intergenic
1026300128 7:69090507-69090529 GGGGAAGGACAGGAGCAGCGAGG + Intergenic
1026308840 7:69166273-69166295 GGGGAAGGGGAGGGGGAGGGGGG + Intergenic
1026669976 7:72381689-72381711 GGGGCCTGTCAGGGGCATGGGGG + Intronic
1026781078 7:73267892-73267914 GACAAATGAGAGGGGCAGGGTGG - Intergenic
1026983120 7:74538068-74538090 GGGGCAAGGCTGGGGCAGGGTGG + Intronic
1026985944 7:74555321-74555343 GGAGAATGCCAGGGCCAGGATGG - Intronic
1027021932 7:74821334-74821356 GACAAATGAGAGGGGCAGGGTGG - Intronic
1027066089 7:75124583-75124605 GACAAATGAGAGGGGCAGGGTGG + Intronic
1027202051 7:76070098-76070120 GGGGGATGATAGGGACATGGAGG + Intergenic
1027214229 7:76173671-76173693 GGGGCAAGGCTGGGGCAGGGTGG + Intergenic
1027270873 7:76517958-76517980 GGGGTATGACAGGGAGAAGGAGG + Intergenic
1027320635 7:77007789-77007811 GGGGTATGACAGGGAGAAGGAGG + Intergenic
1028471298 7:91209448-91209470 GGGGAAGGAGAGAGGGAGGGAGG - Exonic
1028964857 7:96790795-96790817 GGGGAATGACATGGAAAGGAGGG - Intergenic
1029022708 7:97382307-97382329 GGGGAATGACAAGAGCAGCCAGG - Intergenic
1029348624 7:99997206-99997228 GAGGAAGGACAGAGGGAGGGAGG - Intergenic
1029381092 7:100215317-100215339 GGAGAATGAAAGGGGCGAGGTGG - Intronic
1029392188 7:100282605-100282627 GGGGAAGGGAAGGGGAAGGGGGG - Intergenic
1029451408 7:100643338-100643360 GGGTAATATCAGGGTCAGGGTGG + Intronic
1029575328 7:101399888-101399910 TGGGAAGGCCAGGGGCAGCGGGG - Intronic
1029705747 7:102274873-102274895 GGGGAAGCAAAGGGGCAGGAGGG - Intronic
1030106258 7:105989879-105989901 GCTGAATGACTGGGGCAGGTGGG - Intronic
1030470670 7:109959015-109959037 GGGGCCTGTCAGGGGCTGGGAGG + Intergenic
1031071105 7:117162920-117162942 TGGGAAGGATAGGGGAAGGGAGG - Intronic
1031341286 7:120605234-120605256 GGTGATTGACAGGGGCTTGGGGG - Intronic
1031698286 7:124888873-124888895 GGGGAATGACAGGTTGATGGGGG - Intronic
1031830755 7:126622408-126622430 CCGGAATGACAGGGGAAGGAAGG - Intronic
1032087159 7:128890518-128890540 GGAGAAGGGCAGGGGCTGGGGGG + Intronic
1032934280 7:136711176-136711198 GGGGAGAGACAGAGGGAGGGAGG + Intergenic
1033362371 7:140646844-140646866 ATGGAATGAGAGAGGCAGGGGGG - Intronic
1033610549 7:142960243-142960265 GTGGAATGAAAGGGGTAGGATGG - Intronic
1033647438 7:143316157-143316179 GGGGAAGGACAGGGGCAAGCAGG + Exonic
1033685488 7:143636569-143636591 AGGGGATGACAGAGGGAGGGAGG - Intronic
1033688658 7:143715787-143715809 AGGGGATGACAGAGGGAGGGAGG - Intronic
1033699126 7:143821051-143821073 AGGGGATGACAGAGGGAGGGAGG + Intergenic
1034083307 7:148300843-148300865 GGTGACTGCCAGGGGCTGGGAGG + Intronic
1034091783 7:148370634-148370656 AGGGAAGGGCAGGGGTAGGGGGG - Intronic
1034158706 7:148976588-148976610 GGGCCATGACAAAGGCAGGGAGG - Intergenic
1034459425 7:151190332-151190354 GGGGAGTGGCGGGGGCAGGATGG - Intergenic
1034535033 7:151721053-151721075 GGGGCATGAAGGGGGCAGAGGGG + Intronic
1034998525 7:155593630-155593652 CGGGGCTTACAGGGGCAGGGAGG - Intergenic
1035166879 7:156996031-156996053 GGGGAGGGGGAGGGGCAGGGGGG - Intronic
1035348505 7:158225870-158225892 GGTGTATGACATGGGGAGGGAGG + Intronic
1035521203 8:276064-276086 GGGGAAGGAGAGGGGAAGTGGGG + Intergenic
1036084040 8:5593377-5593399 AAGAAATAACAGGGGCAGGGTGG - Intergenic
1036452881 8:8883798-8883820 GGGGAATGAGTGGGGAAAGGAGG - Intronic
1036761803 8:11514617-11514639 GTGCAATCACAGGGGCTGGGTGG - Intronic
1036781722 8:11652354-11652376 GGGGACTGCCAGGGGCTGGGGGG - Intergenic
1037023024 8:13997712-13997734 TGAGAAAGACAGGGGCAGAGAGG - Intergenic
1037121856 8:15298297-15298319 GGGGGATGACTGGAGCATGGGGG - Intergenic
1037465609 8:19157150-19157172 GGGGCAGGACAGGTGCAGAGGGG - Intergenic
1037724511 8:21472339-21472361 AGGGAAGGACAGAGGGAGGGAGG + Intergenic
1037760987 8:21741419-21741441 AGAGAATAACAGGGGCAGAGAGG - Intronic
1037838727 8:22229574-22229596 GGGGAGTGACAGCGTCTGGGAGG + Intronic
1037844164 8:22268007-22268029 GGGGAATGACGCAGGGAGGGAGG - Intergenic
1038018004 8:23530711-23530733 GGGGAAAGTTAGGAGCAGGGAGG + Intronic
1038150961 8:24942150-24942172 GGGGAAGGAGAAGGGGAGGGAGG - Intergenic
1038320639 8:26523481-26523503 GGTGATTGCCAGGGGCTGGGAGG - Intronic
1038432299 8:27510061-27510083 TGGAGAAGACAGGGGCAGGGAGG - Intronic
1039411965 8:37362406-37362428 GGGGAATGCCAGAGGGTGGGAGG + Intergenic
1039576267 8:38626367-38626389 GGGGAAGTACAGTGGCAGTGGGG - Intergenic
1039576430 8:38627445-38627467 GGGGAGTGACAGGGTTGGGGTGG + Intergenic
1039775467 8:40732041-40732063 GGTGATTGCCAGGGGCTGGGAGG + Intronic
1041142649 8:54839603-54839625 GGTGAAGGGCAGGGACAGGGAGG - Intergenic
1041242785 8:55862509-55862531 GGTGGCTGGCAGGGGCAGGGAGG - Intergenic
1041643843 8:60230576-60230598 AGGGAAGGAGAGGGGAAGGGAGG - Intronic
1041878313 8:62715886-62715908 GGGGCATAAAAGGAGCAGGGTGG + Intronic
1042047682 8:64672407-64672429 GGGGAATAATAGGGTCAGAGAGG - Intronic
1042102003 8:65283926-65283948 GGGGAGTGACAGAGAGAGGGAGG + Intergenic
1042865026 8:73349454-73349476 AGGCAACGGCAGGGGCAGGGTGG - Intergenic
1042984203 8:74565488-74565510 GGGGGATGACAGGAGTAGGGTGG + Intergenic
1043417243 8:80063904-80063926 GGGGAATGGCAGAGGGAGGGAGG + Intronic
1043958724 8:86390715-86390737 GGGGAGGGAGAGGGGGAGGGAGG + Intronic
1044321295 8:90804362-90804384 GGGGAGTGAAAGGAGTAGGGAGG + Intronic
1044684915 8:94817369-94817391 GGGGAAGGAGTGGGGGAGGGGGG - Intronic
1044698922 8:94949208-94949230 GGGGAAGGACGCGGGCGGGGCGG + Exonic
1044731642 8:95233109-95233131 GGGGTGGGACATGGGCAGGGAGG - Intergenic
1044935569 8:97290448-97290470 GGGGAAAGACAGGGATGGGGGGG + Intergenic
1044935786 8:97292408-97292430 GGGGGATGGCAGGGACGGGGAGG + Intergenic
1045224653 8:100232591-100232613 AGGGAATGACAGGGGGATGGTGG - Intronic
1045322369 8:101091759-101091781 GTCGAAAGACAGGGGCAGGATGG - Intergenic
1045777848 8:105826880-105826902 GGGGAAAGACAGGCACAGGAGGG - Intergenic
1046805307 8:118473527-118473549 TGGGAATAACAGAGTCAGGGTGG - Intronic
1046936178 8:119887478-119887500 GGGGAAGGGAAGGGGAAGGGAGG - Intronic
1047121808 8:121913149-121913171 GGGGCCTGTCAGGGGCTGGGAGG + Intergenic
1047969288 8:130070962-130070984 GGGGAGAGAGAGGGGGAGGGGGG + Intronic
1048304022 8:133271110-133271132 GGGGATTACCAGGGGCAGCGGGG - Intronic
1048445123 8:134487599-134487621 GGGGAAGGAGTGAGGCAGGGAGG - Intronic
1048466269 8:134667123-134667145 GGGGCCTGTCAGGGGCTGGGAGG + Intronic
1048623599 8:136160882-136160904 GTGGGAGGACAGGGGCATGGAGG + Intergenic
1048765229 8:137836619-137836641 AGGGAAAGACATGGGGAGGGTGG - Intergenic
1049049804 8:140185617-140185639 GGGCAATGACATGTACAGGGTGG - Intronic
1049272305 8:141702473-141702495 AGGGAGTGACAGGGACACGGAGG - Intergenic
1049318142 8:141980575-141980597 GGGCAATGACAGAGGCTGGTTGG + Intergenic
1049345749 8:142137718-142137740 TGGGAAGGTCAAGGGCAGGGAGG - Intergenic
1049526106 8:143127691-143127713 GGGGAATGAGAGGGGAATGGTGG + Intergenic
1049526179 8:143127901-143127923 GGGGAATGGGAGGGGCATGGCGG + Intergenic
1049526187 8:143127922-143127944 GGGGAATGGCAGGGCATGGGAGG + Intergenic
1049640218 8:143711921-143711943 GCGGGAAGACAGGGGCACGGTGG - Intronic
1050695904 9:8278913-8278935 GGGAAATAACAGGGGCAGACAGG - Intergenic
1051548242 9:18300450-18300472 GGGGCCTGTCAGGGGGAGGGGGG + Intergenic
1051732463 9:20159531-20159553 GGTAAATGATAGGGGTAGGGAGG + Intergenic
1051885232 9:21885577-21885599 GGGGACTCACTGGGGCAGGGTGG - Intronic
1052381888 9:27780659-27780681 GGGGACTGTCAGGGGGTGGGGGG - Intergenic
1052435107 9:28417207-28417229 GGGACATGAAATGGGCAGGGAGG + Intronic
1052475675 9:28956579-28956601 GAGGAAGGAAAGGGGGAGGGAGG - Intergenic
1052980934 9:34448833-34448855 GGGGACTCACAGGGGAAGGGTGG + Intronic
1053125699 9:35579164-35579186 GGGGAATTGCTGGGGGAGGGTGG - Intergenic
1053250620 9:36571544-36571566 GGGGAAGGGAAGGGGAAGGGAGG - Intergenic
1053721469 9:40951125-40951147 GGGGGATGGTGGGGGCAGGGAGG + Intergenic
1053792584 9:41697227-41697249 GGGAACTGAAAGGGGAAGGGTGG + Intergenic
1054344527 9:63901043-63901065 GGGGGATGGTGGGGGCAGGGAGG - Intergenic
1055485985 9:76756834-76756856 GGGGCAGGGCACGGGCAGGGTGG - Intronic
1055912027 9:81364050-81364072 GGGGTTTGGCAGGGGCATGGTGG + Intergenic
1056803838 9:89712913-89712935 GGTGAGGGGCAGGGGCAGGGTGG + Intergenic
1057169182 9:92950629-92950651 GGGGAAAGAAGGGGGCAGGAGGG + Intronic
1057190199 9:93083066-93083088 GGGGAGTGAGAGAGCCAGGGCGG + Intronic
1057280017 9:93702403-93702425 GAGGAATGCCTGGGGCAGGCAGG + Intergenic
1058063406 9:100523168-100523190 AGGGAATAACAGGGGCAAAGTGG - Intronic
1058250045 9:102681964-102681986 GGGGAATGAGAGGGAAATGGGGG + Intergenic
1058619800 9:106870990-106871012 GGGAAATGCCAGAGGCTGGGGGG + Intronic
1058700818 9:107598625-107598647 GGAGAATGACAGGGGTAGAGTGG - Intergenic
1058839514 9:108892453-108892475 GGTTAATGGCATGGGCAGGGTGG + Intronic
1059021379 9:110579930-110579952 GGAGAATGAGAGGGGGAGGAGGG - Intergenic
1059150267 9:111943143-111943165 TGGAAATGGCAAGGGCAGGGAGG + Intergenic
1059328134 9:113517183-113517205 GGGGGATGGCGGGGGCTGGGAGG + Intronic
1059395422 9:114031409-114031431 GTGGGATGACAGGGGTCGGGGGG + Intronic
1059654948 9:116349126-116349148 GGGGATTGCAAGGAGCAGGGGGG - Intronic
1060031200 9:120216433-120216455 GGGGAGAGAACGGGGCAGGGAGG + Intergenic
1060227979 9:121807750-121807772 ACGGGAGGACAGGGGCAGGGTGG + Intergenic
1060269052 9:122128387-122128409 GGGGCAGGAGAGGGGCATGGCGG - Intergenic
1060435015 9:123585843-123585865 GGGGAGTGAGAGAAGCAGGGTGG - Intronic
1060528221 9:124332485-124332507 TGGGACAGACAGGGGCAGGTGGG - Intronic
1060743876 9:126117162-126117184 TGGGACTGCCAGGGGCAGGCTGG + Intergenic
1061034599 9:128106672-128106694 GGGGTCTGCCAGGGGCAGGCAGG - Intronic
1061222498 9:129260296-129260318 GGGCAATGAAAGGGTCTGGGGGG - Intergenic
1061625327 9:131837932-131837954 GGGGGATGGCAGGAGCAGAGGGG - Intergenic
1062037859 9:134390674-134390696 TGGGAGTGGCAGAGGCAGGGAGG + Intronic
1062099246 9:134719640-134719662 AGGGCAGGACAGGGGCAGGGCGG + Intronic
1062150475 9:135015909-135015931 TGGGAATGGCAGGTGAAGGGTGG + Intergenic
1062184751 9:135211967-135211989 GGGGAATGCCAGCTGCAGAGAGG + Intergenic
1062191406 9:135249650-135249672 GGGGAGGGAGAGGGGGAGGGAGG + Intergenic
1062194742 9:135266748-135266770 GGGGAGTGACAGGAGCCAGGAGG - Intergenic
1062439675 9:136564153-136564175 GGGGTATGACGGGGCCAGGGAGG - Intergenic
1062533179 9:137010564-137010586 GGGGTAGGCCAGGGCCAGGGGGG - Intronic
1186246727 X:7622866-7622888 AGGGAAGGACAGAGGAAGGGAGG - Intergenic
1186390209 X:9151213-9151235 GGGGAATGGCTGGGGCCAGGTGG - Intronic
1186393628 X:9185852-9185874 GGGGAAGGGCAGGGGCACAGAGG - Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1186682051 X:11885372-11885394 GGTGATTGACAGGGGCTGGGGGG + Intergenic
1186929694 X:14375064-14375086 GGGGCCTGTCAGGGGCTGGGGGG + Intergenic
1187102123 X:16204244-16204266 GGGGACTGGCAGGGGGAGGTGGG + Intergenic
1187241859 X:17521210-17521232 GAGGGATGGCAGGGGCAGGGTGG + Intronic
1187506996 X:19886807-19886829 GGGGGTTGACAGGGGTTGGGGGG - Intronic
1187814311 X:23214565-23214587 GGGGACTGTCAGGGGATGGGGGG + Intergenic
1189018743 X:37312256-37312278 GGGCAAGGATAGGAGCAGGGAGG - Intergenic
1189032357 X:37463489-37463511 GGGCAATGACAGGGGCAGCTGGG + Intronic
1189865298 X:45321294-45321316 GTGGGGGGACAGGGGCAGGGAGG + Intergenic
1190155946 X:47992592-47992614 GGGGACAGAGAGGGGCACGGGGG - Intronic
1190277719 X:48910001-48910023 GGGGAACGGAAGGGGCAAGGGGG + Intronic
1190359697 X:49637222-49637244 GGGGGATGCCAGGGGCTGAGGGG + Intergenic
1192550879 X:72052628-72052650 GAGGAATGAGAGGGACATGGGGG - Intergenic
1192576292 X:72245778-72245800 TGGAAATGACAGGGACTGGGAGG + Intronic
1192591412 X:72363045-72363067 CAGGAAAGACAAGGGCAGGGTGG + Intronic
1193703982 X:84798056-84798078 GGGAAAGGAGAGGGGAAGGGAGG - Intergenic
1195321800 X:103727028-103727050 GGGGAATGACCTGCCCAGGGTGG - Intronic
1195623416 X:106982559-106982581 GGGGAATGTGAGGGACAAGGAGG - Intronic
1195675504 X:107504399-107504421 TGGGAAGGAGAGGGGAAGGGAGG + Intergenic
1195948838 X:110245474-110245496 GGGGAATGACAAGGGAAGCTGGG + Intronic
1196019641 X:110976947-110976969 GGGGCATGTCAGGGGTTGGGGGG + Intronic
1196073957 X:111554135-111554157 GGGGCCTGTCAGGGGCTGGGGGG + Intergenic
1196155762 X:112427925-112427947 GGGGACTCAGAGGGGAAGGGTGG - Intergenic
1197122888 X:122913286-122913308 GGTGATTGACAGGGGCTGAGTGG + Intergenic
1197187244 X:123601458-123601480 GGAGAATGAAAGGAGGAGGGAGG + Intronic
1197979384 X:132199539-132199561 AGGAAATGGCGGGGGCAGGGGGG - Intergenic
1198487743 X:137105359-137105381 GGGAAAAGACAGAGACAGGGAGG + Intergenic
1198652614 X:138879660-138879682 GGGGACTGTCAGGGGGTGGGGGG - Intronic
1199275382 X:145936043-145936065 GGTGGATGAGAGGGGCGGGGAGG + Intergenic
1200071088 X:153529741-153529763 GGGGACGGACAGTGGAAGGGTGG - Intronic
1200098357 X:153674561-153674583 GAGAATTGGCAGGGGCAGGGCGG - Intronic
1200210396 X:154344455-154344477 GGGGAGGGGCCGGGGCAGGGAGG + Intergenic
1200218838 X:154380690-154380712 GGGACATGACAGGGCCATGGTGG + Intronic
1200220456 X:154387637-154387659 GGGGAGGGGCCGGGGCAGGGAGG - Intergenic
1200743808 Y:6884270-6884292 GGGGCCTGTCAGGGGCTGGGGGG + Intergenic
1200798586 Y:7364188-7364210 GGGGAAAGTCAGGGGCATGGGGG - Intergenic