ID: 1124235717

View in Genome Browser
Species Human (GRCh38)
Location 15:27988053-27988075
Sequence GTGAATACGCATGAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124235711_1124235717 30 Left 1124235711 15:27988000-27988022 CCACTGAGAGCTGACGGTGGAGC 0: 1
1: 0
2: 2
3: 13
4: 182
Right 1124235717 15:27988053-27988075 GTGAATACGCATGAGGAGACAGG 0: 1
1: 0
2: 0
3: 4
4: 76
1124235715_1124235717 -8 Left 1124235715 15:27988038-27988060 CCAATGTAGCTTCACGTGAATAC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1124235717 15:27988053-27988075 GTGAATACGCATGAGGAGACAGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124235717 Original CRISPR GTGAATACGCATGAGGAGAC AGG Intronic
914890690 1:151619970-151619992 GTGAATATGCCTAAGAAGACTGG + Intronic
916265987 1:162890278-162890300 GAGAATAGGCATAAGGAGAGGGG + Intergenic
919329674 1:196155027-196155049 TTGAATATAAATGAGGAGACTGG + Intergenic
922754652 1:228089011-228089033 GAGAACACGCAGGAGGAGGCTGG + Intronic
1064855150 10:19759286-19759308 GTAAACACGCATGAGAAGAACGG - Intronic
1069892905 10:71662977-71662999 GAGAAGACGCATGCAGAGACTGG - Intronic
1076180025 10:128399845-128399867 GAGACCACGCATGAGGAGCCAGG - Intergenic
1076216153 10:128694921-128694943 GTTAATATGCATGAGGAGGGAGG - Intergenic
1078973637 11:16445660-16445682 GTGAGTACCCTTGAGGAGGCTGG + Intronic
1083742771 11:64719806-64719828 GTGAGTAAGCATGAGGTGCCTGG + Intronic
1085581635 11:77656256-77656278 GTGAATATGCTTGATGAGGCAGG + Intergenic
1089006455 11:115095440-115095462 GTGAATACACAAGATGAGCCCGG + Intergenic
1089737043 11:120556709-120556731 GTGTATATGCAGGAGGTGACAGG - Intronic
1091804015 12:3343155-3343177 GTGAATTTGCATGAGAGGACGGG - Intergenic
1092527758 12:9319597-9319619 TTGAATACTCATGAGGACCCAGG + Intergenic
1092589783 12:9941836-9941858 GAGAATGAGCATGAGGAGAATGG + Intergenic
1097600828 12:61690804-61690826 GTGAATAGGACTGAGGTGACAGG + Intergenic
1102512011 12:113422288-113422310 GTGAAGACGGAGGAGGAGAGGGG - Exonic
1104111903 12:125712011-125712033 GTGAAGACGGATGCAGAGACTGG + Intergenic
1104435475 12:128752926-128752948 GTGAACACCCCTGAGTAGACAGG + Intergenic
1104622892 12:130331624-130331646 GTGCGTATGCATGAGGAGGCGGG + Intergenic
1104873170 12:132015069-132015091 GTGCATGCGCATGTGGAGCCTGG + Intronic
1114586785 14:23822444-23822466 TTGAATACGAATGATGAGACAGG + Intergenic
1118490412 14:66253779-66253801 GTGAATTTGCATGGTGAGACAGG - Intergenic
1123457883 15:20442643-20442665 GTGAAGACGCAGGCAGAGACTGG + Intergenic
1123660186 15:22557766-22557788 GTGAAGACGCAGGCAGAGACTGG - Intergenic
1124235717 15:27988053-27988075 GTGAATACGCATGAGGAGACAGG + Intronic
1124264031 15:28217796-28217818 GTGAAGACGCAGGCAGAGACTGG + Intronic
1124314045 15:28652261-28652283 GTGAAGACGCAGGCAGAGACTGG - Intergenic
1127930823 15:63596252-63596274 GTGAAGCAGCATGAGGAAACGGG + Intergenic
1133104860 16:3500894-3500916 GTGCATACGCACGGGGAGAGCGG - Intergenic
1136472479 16:30490509-30490531 GTGAAGAGGCAGGAGGAGCCAGG - Intronic
1141981256 16:87551748-87551770 GTGAAGATGGAGGAGGAGACTGG + Intergenic
1148871070 17:50659059-50659081 GTGAATAGGCTTGAGGTCACTGG - Intronic
1164526761 19:29018717-29018739 GTGAAGACGCAAGTGGAGAGGGG + Intergenic
1166208745 19:41291589-41291611 CTGAAAACTGATGAGGAGACAGG - Intronic
1166823758 19:45596908-45596930 GTGACTCCGGATGAGGAGTCTGG - Intronic
925259196 2:2515437-2515459 CTGAATACACATGAGGGGCCAGG - Intergenic
925966427 2:9071280-9071302 GTGACTAAGCCTGAGCAGACAGG - Intergenic
929038311 2:37718541-37718563 ATGAATACACATGAGAAGAAGGG - Intronic
930023620 2:47016312-47016334 GTGAATCAGCATCAGGAGACTGG + Intronic
935125988 2:100223371-100223393 TTGAATAGGCAAGAGGGGACAGG - Intergenic
937626944 2:124054566-124054588 GTCAAAAAGCATGAGGAGAGAGG + Intronic
943041142 2:182807095-182807117 GTGAAATTGCATGGGGAGACAGG - Intergenic
1170164204 20:13345021-13345043 GTAAATGTGCATGAGGAGGCTGG - Intergenic
1172527064 20:35606295-35606317 GTGAGTAGGCCTGGGGAGACAGG - Intergenic
1175491596 20:59384080-59384102 GTGAATGGGCAGGAGGTGACTGG + Intergenic
1179196835 21:39171981-39172003 GTTAAGATGCATGAGGAGAGTGG - Intergenic
1179775581 21:43659773-43659795 GTGAAGACGCAGAGGGAGACAGG + Exonic
1181868530 22:25879052-25879074 GTGAAAATGAATGAAGAGACAGG + Intronic
962849138 3:139294899-139294921 TTTAAGACGGATGAGGAGACAGG + Intronic
965361036 3:167738207-167738229 GTGAATATGTATGATGAGAAAGG + Intronic
972814991 4:42634717-42634739 TTGCATATGCATGAGGAGCCAGG - Intronic
973218411 4:47697762-47697784 GAGAATTCCCATGAGGAGAAAGG + Intronic
974863831 4:67555669-67555691 CTGAAAAGGTATGAGGAGACAGG + Intergenic
982173184 4:152681126-152681148 GTGCAAACGTATGAGGTGACTGG + Intergenic
986604107 5:9504479-9504501 GTGGATTCACATCAGGAGACAGG + Intronic
987318564 5:16747024-16747046 GTGAATACCCATTTGGAGATGGG + Intronic
987442314 5:17970553-17970575 GTGAAGATCCATGAGGACACTGG + Intergenic
987642929 5:20634424-20634446 GTGTGTAGGCATGAGCAGACTGG - Intergenic
988203339 5:28098737-28098759 GTGGATCCTCATGATGAGACAGG + Intergenic
1013041515 6:106438546-106438568 GTGACAATGCAGGAGGAGACTGG - Intergenic
1018674367 6:166206221-166206243 GTGAAGACGGAGGTGGAGACCGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022877853 7:34553189-34553211 GTGAAAGCCCACGAGGAGACTGG + Intergenic
1022910850 7:34898611-34898633 GTGAATAGGCATGAGGAACAGGG - Intergenic
1024700297 7:51899319-51899341 GTGAGGACGCAGGAGAAGACAGG - Intergenic
1029734717 7:102459258-102459280 GGGAATGCGTGTGAGGAGACAGG + Intronic
1030041220 7:105452177-105452199 GTAAATATGCATTAGGAGACAGG + Intronic
1030640084 7:111994991-111995013 GAGAATATGCATGAGGAGATGGG + Intronic
1031699966 7:124912664-124912686 TTGAATACCTATGAGGAGTCAGG - Intronic
1038461645 8:27722335-27722357 GTGAAGATGCATGAAGACACAGG + Intergenic
1045663049 8:104457956-104457978 GTGAAGACGCAGGAGTAGAGAGG - Intronic
1046152477 8:110246157-110246179 TTGAATAGGAATGAGGAGAGTGG + Intergenic
1047327059 8:123849916-123849938 GTGAATATGAATGAGAAGAATGG + Intergenic
1047642362 8:126834091-126834113 GTGCATACACATGATGAAACAGG + Intergenic
1049850567 8:144827942-144827964 GTGATTTCGCAGGAGGAGTCAGG - Intronic
1053581108 9:39405169-39405191 GTGAATACGAAGGCAGAGACTGG - Intergenic
1054102695 9:60963973-60963995 GTGAATACGAAGGCAGAGACTGG - Intergenic
1055155301 9:73055563-73055585 ATGAATAAGAATGATGAGACTGG - Intronic
1057820471 9:98326447-98326469 GAGAATATGCATGAGCAGATGGG - Intronic