ID: 1124237767

View in Genome Browser
Species Human (GRCh38)
Location 15:28004435-28004457
Sequence TGCCCCGCTGGCGTCCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124237767_1124237770 -9 Left 1124237767 15:28004435-28004457 CCTGCGGGGACGCCAGCGGGGCA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1124237770 15:28004449-28004471 AGCGGGGCACCCGGACCGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124237767 Original CRISPR TGCCCCGCTGGCGTCCCCGC AGG (reversed) Intronic