ID: 1124237767

View in Genome Browser
Species Human (GRCh38)
Location 15:28004435-28004457
Sequence TGCCCCGCTGGCGTCCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124237767_1124237770 -9 Left 1124237767 15:28004435-28004457 CCTGCGGGGACGCCAGCGGGGCA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1124237770 15:28004449-28004471 AGCGGGGCACCCGGACCGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124237767 Original CRISPR TGCCCCGCTGGCGTCCCCGC AGG (reversed) Intronic
900419016 1:2547569-2547591 TGCCCCGCTGGCCTCTACCCTGG + Intergenic
900567629 1:3341383-3341405 TGCCCCCCTTGCTTCCCCTCTGG - Intronic
901242863 1:7704951-7704973 CGCCCCGCGCGCGCCCCCGCCGG - Intronic
903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG + Intergenic
904563285 1:31413024-31413046 TGCGCCGCTCGCGTGGCCGCGGG + Intronic
905177915 1:36149498-36149520 TGCCCCGCGGGAGGCCGCGCAGG - Intronic
908539200 1:65106541-65106563 TGCACCGCTGAGGTCCCTGCAGG - Intergenic
912405488 1:109434241-109434263 TGCCCCGCTGGGGACCCTGTGGG + Intergenic
918527425 1:185480113-185480135 TGCCCAGCTGGCAGCCCAGCAGG + Intergenic
920184647 1:204152224-204152246 CGCCCCGCCCGGGTCCCCGCCGG + Intergenic
922024618 1:221739120-221739142 TGCCCTGCTGCAGTCTCCGCCGG + Exonic
1063458973 10:6203518-6203540 TGTCCCGGTGGCTGCCCCGCCGG + Intronic
1070032664 10:72692362-72692384 TGCCCCGGCGGCCTGCCCGCCGG - Intronic
1075102329 10:119515303-119515325 TGCCCCACAGGAGTCCCCCCAGG - Intronic
1076981402 11:206927-206949 TGCTCCGCTGGTGTCCAAGCAGG - Intronic
1077372517 11:2190095-2190117 TGCCCCCCTGGCCTCCCGGGAGG - Intergenic
1077844872 11:6013354-6013376 TGCCCAGCTCGCGGCCCTGCAGG + Intergenic
1080659129 11:34281555-34281577 TGCCCAGCGGGAGTCCCCGAAGG - Intronic
1081831475 11:46119885-46119907 TCCCCCGCCCGCGCCCCCGCCGG - Intronic
1083953140 11:65967692-65967714 TCCACCGCCGGGGTCCCCGCAGG + Exonic
1092123463 12:6060249-6060271 TGCCCTGCTGGCTGCCCTGCAGG - Intronic
1102558120 12:113742341-113742363 TGCCCCGCTGGCCTCCACCCCGG + Intergenic
1105406107 13:20133905-20133927 TGCCCCTCTGGGGTCCACCCTGG - Intergenic
1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106181465 13:27373065-27373087 TGCTCCTCTGACGTCCCCACCGG + Intergenic
1107624803 13:42271857-42271879 TGCCCCGCGGGCTGCTCCGCGGG + Intergenic
1114674577 14:24431756-24431778 TGCCCTGCTGCAGTCCCCGGGGG + Exonic
1115235834 14:31207807-31207829 TCCCCCGGCGGCGACCCCGCCGG + Intergenic
1115257739 14:31420558-31420580 TGCCTCGCTGTCGCCGCCGCCGG - Exonic
1122264099 14:100538670-100538692 GGCCGCGGTGGCGGCCCCGCTGG - Exonic
1122327958 14:100893903-100893925 AGCCTCGCTGGCGTCCTCACTGG + Intergenic
1122353505 14:101110812-101110834 TGCCCCGCTGGTGCCTCTGCTGG + Intergenic
1123783113 15:23646008-23646030 TGCCCCACTGTCTGCCCCGCAGG - Exonic
1123964005 15:25438230-25438252 GGGCCCGCTCGCGTCCCCTCGGG + Intronic
1124237767 15:28004435-28004457 TGCCCCGCTGGCGTCCCCGCAGG - Intronic
1129523580 15:76200586-76200608 TGGCCCTCTGGAGTCCCTGCGGG + Intronic
1129606370 15:77027139-77027161 TGCCTCGCTGGTCTCCCAGCTGG + Intronic
1129842081 15:78750146-78750168 TGCCACCCTGGCCACCCCGCTGG + Intergenic
1131484657 15:92809596-92809618 TGCGCCGCGGGATTCCCCGCAGG - Intronic
1132672027 16:1105997-1106019 TGCCCACCTGCAGTCCCCGCGGG + Intergenic
1132803801 16:1766579-1766601 TGCTCCCGTGGGGTCCCCGCTGG - Exonic
1132809793 16:1792084-1792106 TGCCCAGCTGGCCGCCCTGCAGG + Exonic
1133024074 16:2980162-2980184 CGGCCCGCTCGCGTCCCCTCAGG - Intronic
1133024082 16:2980182-2980204 TGCCCCTCAGGCCTCCCCGGCGG - Intronic
1139440334 16:66963594-66963616 AGCCCAGCTGAGGTCCCCGCAGG + Exonic
1142206248 16:88784604-88784626 AGCGCGGCTGGCGTCTCCGCCGG - Intronic
1142631406 17:1228896-1228918 TGCCCCCGTGGCGGCGCCGCAGG - Intronic
1143584305 17:7843783-7843805 TGCCTACCCGGCGTCCCCGCAGG - Intronic
1143750170 17:9021894-9021916 CCCCCCGATCGCGTCCCCGCCGG - Intronic
1146896332 17:36544807-36544829 GGCCGCGCTGGGGACCCCGCTGG - Intergenic
1150595036 17:66596372-66596394 TGCCCCCCTGCCTTCACCGCTGG + Intronic
1151674076 17:75589050-75589072 AGCCCCGCTGGCGGCCCTCCTGG + Intergenic
1152462594 17:80449378-80449400 GGCCCCGCTGCCGTCCCCGTTGG - Intergenic
1161138375 19:2634025-2634047 TGCCCTGCTGAGGTCCCCGGAGG + Intronic
1161236790 19:3202161-3202183 TGCCCCGCTGAGGTCCCAGGAGG + Intronic
1161276507 19:3421260-3421282 TGCCCAGCTGGCGTCTCAGCAGG - Intronic
1161346662 19:3771751-3771773 TGTCCCGCTGCCGTCCCACCAGG - Exonic
1162144450 19:8605291-8605313 TGCCCCGTTGTGGTCCACGCGGG + Exonic
1163537247 19:17883841-17883863 TGCCCCCAGGGCGTCCTCGCGGG + Exonic
1166518789 19:43465582-43465604 TGCTCCCTTGGCGTCCCCCCTGG + Exonic
1168293005 19:55366123-55366145 GGACCCGCCGGCGCCCCCGCTGG - Exonic
929272921 2:39993418-39993440 AGCCACACTGGCCTCCCCGCAGG - Intergenic
929454110 2:42054378-42054400 TGCCCAGCTGGCCTCCACGTTGG - Intronic
929827646 2:45321831-45321853 TGGCCTGCTGGCATCCTCGCTGG - Intergenic
932306356 2:70706360-70706382 TGCCTCGCCGCCGCCCCCGCAGG - Exonic
934716937 2:96549924-96549946 TGCCTCCCTGCCTTCCCCGCTGG + Intronic
938066031 2:128282555-128282577 TGCCCATCTGGCTTCCCAGCAGG - Intronic
948479339 2:238240238-238240260 CGCCCCGGTGCCGCCCCCGCGGG - Intronic
1174506821 20:51022713-51022735 TGTCGCCCTGGCCTCCCCGCAGG + Intronic
1175523326 20:59616951-59616973 TTCCCCGCTCGCTTCCCCGTTGG + Intronic
1176130548 20:63494996-63495018 TGCCCTGCTGGCCTACACGCTGG - Exonic
1180614775 22:17120234-17120256 CGCGCCGCCGGCGCCCCCGCGGG + Exonic
1180795890 22:18605143-18605165 TTCCCCGAGGGCATCCCCGCAGG - Intergenic
1181225834 22:21390128-21390150 TTCCCCGAGGGCATCCCCGCAGG + Intergenic
1181252799 22:21544685-21544707 TTCCCCGAGGGCATCCCCGCAGG - Intergenic
1181521523 22:23451123-23451145 TGCCACGCTGGCGTCATGGCTGG - Intergenic
1183544620 22:38448902-38448924 TGCCCTGCTGGGGGCCCCCCAGG + Intronic
1184229552 22:43151432-43151454 GGGCCCACTCGCGTCCCCGCGGG - Intergenic
1184473059 22:44706856-44706878 TGCCCGGCTGGCCTGCCGGCCGG + Intronic
1184502678 22:44883259-44883281 TGCCCCTCTGGCGGGCCAGCAGG + Exonic
1184662489 22:45971838-45971860 GGCGCCGCTCGCGTGCCCGCGGG + Intronic
1185224046 22:49643099-49643121 TCCCCAGCTGGCGTCCACTCAGG - Intronic
950422725 3:12908232-12908254 TGCCGCACTGGCTTCGCCGCAGG + Intronic
953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG + Intronic
954302068 3:49705401-49705423 TGCCCCCATGGGCTCCCCGCGGG + Intronic
954747884 3:52797289-52797311 CACCCCGCTGCCGTCCCCCCAGG - Intronic
961322362 3:126084367-126084389 GGCCCCACTGGCGCCCCCGCGGG + Intronic
962062577 3:131945877-131945899 TGCACTGCTGGCCTCCACGCGGG - Intronic
967856446 3:194121388-194121410 TGCCCAGCTGTGGTCCCAGCTGG - Intergenic
968483738 4:848938-848960 TGCCCCTGTGCCATCCCCGCAGG - Intergenic
972284472 4:37635046-37635068 TGCTTCCCTGGCGTCCCCCCTGG + Exonic
972960462 4:44447477-44447499 AGCCCCGCTGGAGGCCCCGCGGG - Intronic
980328428 4:131379394-131379416 TGCGCCGGTGGCGCTCCCGCCGG + Intergenic
984928477 4:184826387-184826409 TGCCCCGCTGGCCTCCTGGCAGG + Intronic
986048773 5:4067277-4067299 TGCACACCTGGCTTCCCCGCTGG - Intergenic
994320796 5:98392433-98392455 TGCCCCGCAGCCGGCCCAGCAGG - Intergenic
997639956 5:135442620-135442642 TGCCCCTCAGGAGTCCCTGCAGG + Intergenic
998092252 5:139378351-139378373 TTCCCCGCTGGCTCCCCGGCAGG - Exonic
999869954 5:155739362-155739384 AGCCCCACTGGCTTCCACGCTGG - Intergenic
1003194956 6:3906302-3906324 TGTCCCGCTGGTGTGCCAGCAGG - Intergenic
1011426697 6:87239280-87239302 TGCCCAGCTGGCGCCCCGTCCGG - Intronic
1018683217 6:166281914-166281936 TGCCCCATTGGCCTCCCCGTAGG - Intergenic
1019274219 7:167338-167360 TGGCCGGCTGGCGTCCCCTTTGG + Intergenic
1022172676 7:27844776-27844798 TGCCCCGTTGGAGCCCCAGCTGG - Intronic
1022286421 7:28958644-28958666 TTCTCCGCCTGCGTCCCCGCGGG - Intergenic
1022510819 7:30933819-30933841 TGCCCTGCAGGGGTCCCCGAAGG - Intergenic
1040950984 8:52939212-52939234 TCCGCAGCTCGCGTCCCCGCCGG - Exonic
1047203087 8:122782429-122782451 CGTCCCGGTGGAGTCCCCGCGGG - Intronic
1058943118 9:109832837-109832859 TGCCCCGCTGGCCTCTCTGAGGG - Intronic
1061208598 9:129178056-129178078 TGCTCCGCCGCCGTCTCCGCGGG - Exonic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1062498366 9:136842100-136842122 TGCCCCACTGGCCTCTCCCCAGG - Intronic
1190908333 X:54749958-54749980 TGCCCCGCTGGGCTTCCTGCTGG - Exonic
1200034572 X:153319283-153319305 AGCCTCGCTGGCGTCCCCCTGGG + Intergenic