ID: 1124237770

View in Genome Browser
Species Human (GRCh38)
Location 15:28004449-28004471
Sequence AGCGGGGCACCCGGACCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124237756_1124237770 20 Left 1124237756 15:28004406-28004428 CCTGACTTCCAAGCTGGGCTGCA 0: 1
1: 0
2: 2
3: 26
4: 275
Right 1124237770 15:28004449-28004471 AGCGGGGCACCCGGACCGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 69
1124237755_1124237770 21 Left 1124237755 15:28004405-28004427 CCCTGACTTCCAAGCTGGGCTGC 0: 1
1: 0
2: 1
3: 17
4: 265
Right 1124237770 15:28004449-28004471 AGCGGGGCACCCGGACCGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 69
1124237752_1124237770 27 Left 1124237752 15:28004399-28004421 CCGAGGCCCTGACTTCCAAGCTG 0: 1
1: 0
2: 0
3: 27
4: 256
Right 1124237770 15:28004449-28004471 AGCGGGGCACCCGGACCGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 69
1124237767_1124237770 -9 Left 1124237767 15:28004435-28004457 CCTGCGGGGACGCCAGCGGGGCA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1124237770 15:28004449-28004471 AGCGGGGCACCCGGACCGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 69
1124237760_1124237770 12 Left 1124237760 15:28004414-28004436 CCAAGCTGGGCTGCAGGGGAGCC 0: 1
1: 0
2: 4
3: 79
4: 1640
Right 1124237770 15:28004449-28004471 AGCGGGGCACCCGGACCGTCTGG 0: 1
1: 0
2: 0
3: 8
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124237770 Original CRISPR AGCGGGGCACCCGGACCGTC TGG Intronic