ID: 1124240132

View in Genome Browser
Species Human (GRCh38)
Location 15:28021613-28021635
Sequence TCTTCCTGGGGAGCGTCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124240132_1124240140 1 Left 1124240132 15:28021613-28021635 CCAGCGGACGCTCCCCAGGAAGA 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1124240140 15:28021637-28021659 AGGAAGCCTGGGGAAGATCCCGG 0: 1
1: 0
2: 1
3: 50
4: 427
1124240132_1124240141 2 Left 1124240132 15:28021613-28021635 CCAGCGGACGCTCCCCAGGAAGA 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1124240141 15:28021638-28021660 GGAAGCCTGGGGAAGATCCCGGG 0: 1
1: 1
2: 4
3: 30
4: 324
1124240132_1124240137 -10 Left 1124240132 15:28021613-28021635 CCAGCGGACGCTCCCCAGGAAGA 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1124240137 15:28021626-28021648 CCCAGGAAGACAGGAAGCCTGGG 0: 1
1: 1
2: 3
3: 50
4: 510
1124240132_1124240139 -9 Left 1124240132 15:28021613-28021635 CCAGCGGACGCTCCCCAGGAAGA 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1124240139 15:28021627-28021649 CCAGGAAGACAGGAAGCCTGGGG 0: 2
1: 0
2: 6
3: 43
4: 587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124240132 Original CRISPR TCTTCCTGGGGAGCGTCCGC TGG (reversed) Intronic