ID: 1124244467

View in Genome Browser
Species Human (GRCh38)
Location 15:28057768-28057790
Sequence CGCTGCTGCAGGGGAACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124244457_1124244467 20 Left 1124244457 15:28057725-28057747 CCTCCTGGGCACAAGCCCTCTGA 0: 1
1: 0
2: 5
3: 37
4: 430
Right 1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 260
1124244460_1124244467 5 Left 1124244460 15:28057740-28057762 CCCTCTGAGAGTAAGACAGGTAA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 260
1124244461_1124244467 4 Left 1124244461 15:28057741-28057763 CCTCTGAGAGTAAGACAGGTAAG 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 260
1124244458_1124244467 17 Left 1124244458 15:28057728-28057750 CCTGGGCACAAGCCCTCTGAGAG 0: 1
1: 0
2: 2
3: 24
4: 231
Right 1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124244467 Original CRISPR CGCTGCTGCAGGGGAACAGG TGG Intronic