ID: 1124244467

View in Genome Browser
Species Human (GRCh38)
Location 15:28057768-28057790
Sequence CGCTGCTGCAGGGGAACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124244458_1124244467 17 Left 1124244458 15:28057728-28057750 CCTGGGCACAAGCCCTCTGAGAG 0: 1
1: 0
2: 2
3: 24
4: 231
Right 1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 260
1124244457_1124244467 20 Left 1124244457 15:28057725-28057747 CCTCCTGGGCACAAGCCCTCTGA 0: 1
1: 0
2: 5
3: 37
4: 430
Right 1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 260
1124244460_1124244467 5 Left 1124244460 15:28057740-28057762 CCCTCTGAGAGTAAGACAGGTAA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 260
1124244461_1124244467 4 Left 1124244461 15:28057741-28057763 CCTCTGAGAGTAAGACAGGTAAG 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124244467 Original CRISPR CGCTGCTGCAGGGGAACAGG TGG Intronic
900147889 1:1166352-1166374 CGCCTCTGCAGGGGGGCAGGAGG - Intergenic
900158277 1:1212134-1212156 TGCAGCTGTTGGGGAACAGGAGG + Exonic
900240771 1:1616226-1616248 CGCCGGCGCAGGGGAACGGGCGG - Intronic
900397378 1:2458615-2458637 GGCTGCTCCAGGGGCACAGATGG - Intronic
901000288 1:6145642-6145664 AGCTGCTGCTGGGGCACTGGGGG + Intronic
901052211 1:6430915-6430937 GGCTGATGGAGGGGAACAAGGGG + Intronic
901812639 1:11776593-11776615 CGCTGCTGCTGTGGAAGATGCGG + Exonic
902482024 1:16717096-16717118 GGCTGATGGAGGGGAACAAGGGG - Intergenic
902534234 1:17110016-17110038 GGCTGGTGCTGGGGAATAGGAGG - Intronic
902547232 1:17197738-17197760 GGGTGCTGGAGGGGAAAAGGTGG + Intergenic
903781156 1:25820674-25820696 CGGTGCTGCCGGCGAACCGGGGG + Intronic
905734493 1:40316306-40316328 GACTGCTGCAGGGGAGCAGGAGG + Intronic
906000857 1:42423576-42423598 CCATGCTGCAGGGGCACAGGTGG + Intergenic
906166796 1:43692510-43692532 CTCTGCTGCAGAGGAGCAGCTGG - Intronic
907430118 1:54406580-54406602 TGCTCCTGCAGGCGAACTGGGGG + Intronic
913451459 1:118995431-118995453 AGCTGCTGCTGGGGAAGAGTTGG + Intergenic
915343369 1:155188120-155188142 GGCTGCTTCAGGGGAGCATGGGG + Intronic
915344890 1:155192448-155192470 GGCTGCTGCAGGGAAGGAGGCGG - Intronic
915457153 1:156048497-156048519 CAGTGCTGCCCGGGAACAGGTGG - Exonic
917300829 1:173572273-173572295 CACAGCTGCATGGGAACAGCAGG + Intronic
918376346 1:183913001-183913023 CACAGCTGCAGGGGAAGATGAGG + Intronic
920345622 1:205304064-205304086 CTCTGCAGAAGGGGTACAGGAGG - Exonic
920420811 1:205832120-205832142 GGCTGCAGAAGGGGAACAGAGGG + Intronic
920788302 1:209063905-209063927 AGCGGCTGCAGAGGAGCAGGCGG - Intergenic
921170443 1:212542814-212542836 CACTGCTCTACGGGAACAGGTGG - Intergenic
921672515 1:217941901-217941923 GGCTGGTGCAGGGGACCAGAGGG + Intergenic
921817195 1:219577251-219577273 AGCTGCTCCAGGGGTACAGCTGG + Intergenic
922880897 1:228979578-228979600 CCCTCCTGCAGGGGAAGTGGAGG + Intergenic
923318516 1:232805536-232805558 CGCTGCCGCAGTGGAGCAGGAGG + Exonic
923659277 1:235944596-235944618 CGCAGCTGGAGATGAACAGGAGG + Intergenic
1062854683 10:773991-774013 GGCTGCTGCAGGGGTGCAGGAGG + Intergenic
1065360009 10:24880728-24880750 CACTGCAGCATGGGAACTGGGGG - Intronic
1068544086 10:58327082-58327104 CCCTGCTGCGGGGTGACAGGAGG + Intergenic
1068704070 10:60053636-60053658 GGTTGCTGCATGGAAACAGGTGG + Intronic
1069785561 10:70985879-70985901 AGCTGCTCCAGGGCCACAGGTGG - Intergenic
1071526772 10:86363818-86363840 CGCGGCTGCCGAGGAACAGAGGG + Intronic
1072370900 10:94765648-94765670 AGCTGCTGCAGGGGATCCAGGGG + Intronic
1072722608 10:97790015-97790037 GGGTGCTGCTGGGGTACAGGAGG + Intergenic
1072746918 10:97946789-97946811 GGCTTCTGGAGGGGAATAGGGGG - Intronic
1074618600 10:115093854-115093876 GGCTGCTGGACGGGAACAGCTGG + Exonic
1075247105 10:120832394-120832416 TGCTGTTGCAGGGGCACAGTGGG + Intergenic
1075736617 10:124668335-124668357 CCCTGCGGCAGGGGAGCCGGTGG - Intronic
1076851969 10:133097693-133097715 GGCTGCTGCAGCAGAACACGGGG + Intronic
1077340712 11:2025174-2025196 TTCTTCTGCAGGGGAACATGTGG - Intergenic
1077436084 11:2539865-2539887 CTCTGGTGCAGGGGAGCCGGCGG + Intronic
1078653897 11:13220476-13220498 TGCTGCTCCAGGGGCAGAGGTGG - Intergenic
1080411872 11:32032732-32032754 CGCTGCTGCTGGAGAGCAGAAGG - Intronic
1081662048 11:44894285-44894307 CGCAGTTGCAGGGGAACACACGG + Intronic
1084385961 11:68842777-68842799 CGCAGCTGCAGGGGACCCAGGGG + Intronic
1086246032 11:84754004-84754026 AGCTGCTTCAGTGGAACAGCAGG + Intronic
1087682583 11:101233018-101233040 CGCTGCTGCAGGGGGTCCAGGGG + Intergenic
1088944598 11:114496370-114496392 CACTGCTGCTGGGGAAGGGGTGG + Intergenic
1090279118 11:125441126-125441148 CGCTGCTGCTGGGATAAAGGAGG + Intergenic
1091186153 11:133649661-133649683 GGCTGTTGCAGGGAAACAGAAGG - Intergenic
1202823697 11_KI270721v1_random:80363-80385 TTCTTCTGCAGGGGAACATGTGG - Intergenic
1091463342 12:662699-662721 CACTGCTGGAGGGGAAAGGGTGG - Intronic
1096096654 12:48939905-48939927 AGCTGCAGCAGGGTAACAGTTGG + Intronic
1096482473 12:51951788-51951810 CGCCGCTGCCGGCGAGCAGGAGG - Exonic
1098150851 12:67544865-67544887 CACTGGTGAAGAGGAACAGGGGG + Intergenic
1100565681 12:95791059-95791081 GGGTGCTGCAGGGCACCAGGGGG - Intronic
1101376004 12:104172212-104172234 TGCTCCTGGAGGGGAGCAGGGGG + Intergenic
1103086897 12:118068497-118068519 TGCTGCAGTAGGGGAACAGGAGG - Exonic
1103308907 12:119989279-119989301 TGCTGCTGCAGGGGCCGAGGCGG - Intergenic
1103452512 12:121039163-121039185 TGCTGCAGTAGGGGCACAGGAGG + Exonic
1103649611 12:122422545-122422567 TGCTGCTGCAGTGGGACAGGTGG - Exonic
1103729502 12:123017848-123017870 GCCTGCTGCTGGGGAACATGGGG + Intronic
1104612532 12:130241231-130241253 CTCTGGTCCAGGGGAAGAGGAGG + Intergenic
1104710562 12:130982816-130982838 AGCTGGAGAAGGGGAACAGGTGG + Intronic
1105419419 13:20239481-20239503 GGCTTGTGCAGGGGAACAGGAGG + Intergenic
1107806417 13:44157811-44157833 CCCTGCTGAAGGGCAACATGGGG + Intronic
1108599467 13:51979388-51979410 GGCAGCTGAAGGGGACCAGGTGG + Intronic
1112338861 13:98536705-98536727 GGCTCCTGCAGGGGACTAGGAGG - Intronic
1113458413 13:110465124-110465146 GGCTGATGCAGGGGAGCTGGCGG + Intronic
1113550707 13:111191068-111191090 CGCTGCTGCAGGGGGTCCAGGGG + Intronic
1113649631 13:112026617-112026639 CTCTGCTGGAGGAGGACAGGTGG + Intergenic
1113795309 13:113053771-113053793 CACAGCTGCAGGGACACAGGAGG - Intronic
1118966663 14:70593647-70593669 CACTGCTGGAGGGCAACAGTGGG - Intronic
1119567090 14:75637921-75637943 AACTGCTGGAGGGGCACAGGAGG + Intronic
1120764750 14:88318484-88318506 TGATGGTGCTGGGGAACAGGAGG + Intronic
1122124462 14:99571549-99571571 CACGTCTGCAGGGGAGCAGGCGG + Intronic
1122519266 14:102331795-102331817 TGCTGCGGCAGGGGAGCAGAGGG + Exonic
1122803473 14:104244820-104244842 CGCAGCTGCAGGAGAGCAGAAGG - Intergenic
1122873486 14:104652007-104652029 CCCTGCAGGAGGGGAGCAGGGGG - Intergenic
1202922648 14_KI270724v1_random:1179-1201 GGGTGCTGCAGGGGCACGGGCGG + Intergenic
1123499332 15:20866173-20866195 CCCTGCAGCAGGGGAAGCGGTGG + Exonic
1123556585 15:21439903-21439925 CCCTGCAGCAGGGGAAGCGGTGG + Exonic
1123592806 15:21877138-21877160 CCCTGCAGCAGGGGAAGCGGTGG + Intergenic
1124157015 15:27234875-27234897 AGCTGCTGCAGGAGCCCAGGTGG - Intronic
1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG + Intronic
1127324266 15:57880119-57880141 TGCTGCTGCAGTGGCCCAGGTGG - Intergenic
1127725236 15:61743400-61743422 CACTGCTGCTGGGGAGCAGTTGG - Intergenic
1127800854 15:62476328-62476350 CGCTGCTGCAGGGTGACATCTGG + Intronic
1129002599 15:72346807-72346829 CTTTGCTGCTGGGGAACAGAGGG - Intronic
1129323562 15:74787898-74787920 CCGTGCTGCAGGGAGACAGGAGG + Intronic
1129742284 15:77995106-77995128 CACTGCTGCTGGGCAACTGGAGG - Exonic
1129825707 15:78633876-78633898 TGCTGGGGCAGGGGAGCAGGTGG + Intronic
1130782102 15:87051117-87051139 ACCTGCTGAAGGGGAAGAGGTGG + Intergenic
1131117572 15:89804300-89804322 TGCTGCTGGAGGAGGACAGGGGG + Exonic
1131411734 15:92213204-92213226 CGCTGCTGCAGGGGGTCCAGGGG - Intergenic
1131816441 15:96225980-96226002 TGCTGCTGCTGGGGAGAAGGTGG - Intergenic
1132120418 15:99170793-99170815 GGCTGCAGCAGGAGCACAGGTGG - Intronic
1202964925 15_KI270727v1_random:167092-167114 CCCTGCAGCAGGGGAAGCGGTGG + Intergenic
1132845770 16:2000166-2000188 GGTTGCTGCAGTGGAGCAGGAGG + Exonic
1133054443 16:3138508-3138530 TGCTGCTCCTGGGGAACAGACGG - Exonic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1134490834 16:14694251-14694273 CGGTGCTGCAGGGCCACCGGAGG + Exonic
1134496215 16:14733369-14733391 CGGTGCTGCAGGGCCACCGGAGG + Intronic
1135244123 16:20839781-20839803 CAATGCTGAAGGGAAACAGGGGG - Exonic
1135404223 16:22186703-22186725 TGCTGCTGCAGGGAAGGAGGGGG - Exonic
1136402892 16:30028191-30028213 GGCTGGTGCAGGAGACCAGGAGG + Intronic
1136427809 16:30180907-30180929 GGCTGCAGCAGGGGAAGGGGTGG - Intergenic
1137665180 16:50245737-50245759 CGCTCCTGCAGGGGGAGGGGAGG + Intergenic
1137720485 16:50624879-50624901 CACAGCTGCAGGGAAACAGCTGG + Intronic
1137981286 16:53072205-53072227 AGCAGCTGGAGGGGAACAAGTGG - Intronic
1138494075 16:57396581-57396603 CGCTGCTGCAGGGGGTCCAGGGG + Intergenic
1138546224 16:57721535-57721557 GGCTTCCGCAGGGGAACTGGAGG - Intronic
1139264786 16:65628704-65628726 CGCTGATGCTGGGGCACAGGTGG + Intergenic
1139459429 16:67110036-67110058 CGCTGCCGCCGGGGAGGAGGTGG + Exonic
1139884212 16:70197199-70197221 CTCTGCTTCTTGGGAACAGGAGG + Intergenic
1140368303 16:74398297-74398319 CTCTGCTTCTTGGGAACAGGAGG - Intergenic
1140476843 16:75243250-75243272 CCTTTCTGCTGGGGAACAGGTGG - Intronic
1141964790 16:87434599-87434621 CGGTGGTGCAGGAGACCAGGCGG - Intronic
1143448743 17:7023354-7023376 CGGTGCTGGAGGGGCACTGGGGG + Intronic
1145804851 17:27719321-27719343 CGCTGCTGCAGGGGGTCCAGGGG - Intergenic
1146440067 17:32886044-32886066 TTCTGCTGCAGGTGGACAGGGGG + Intergenic
1148857519 17:50586857-50586879 CGCTGCTGCAAGGTGACAGCCGG + Intronic
1150434128 17:65140969-65140991 TGGAGCTGCAGGGGCACAGGAGG - Intronic
1151842325 17:76627190-76627212 AGCTGCTGCTGGGGCACTGGAGG + Exonic
1151951221 17:77355276-77355298 CGCCGCAGCAGGGGAGCAGCTGG + Intronic
1151963765 17:77420678-77420700 GGCTGCTGCAGGGGAGAGGGTGG - Intronic
1152177328 17:78796443-78796465 CACTGCTGCTGGGACACAGGTGG + Exonic
1155475540 18:26233352-26233374 CGCTGCTGCAGGGGGTCCAGAGG + Intronic
1157222652 18:45838700-45838722 CGCGGCTGCAGGGGAGAAGGCGG - Exonic
1160588872 18:79928718-79928740 CACTGCTGCAGTGGCACTGGGGG - Intronic
1160964937 19:1743186-1743208 GTCCGCAGCAGGGGAACAGGAGG + Intergenic
1161454575 19:4363597-4363619 CGCTGCAGCAGGGGAGGTGGAGG - Intronic
1161971344 19:7582618-7582640 TGCTGGTGGATGGGAACAGGCGG - Intergenic
1162236753 19:9315629-9315651 CGCTGCTGCAGGGGTTCCAGGGG + Intergenic
1162925882 19:13930360-13930382 CGCTGCAGCTGGGGGAGAGGAGG - Exonic
1163742242 19:19022590-19022612 TGCAGCTGCAGGAAAACAGGGGG + Intronic
1165751705 19:38264406-38264428 CCCTGGTGCCGGGGAAGAGGCGG - Intronic
1166712891 19:44948644-44948666 GGCTGCAGCAGGGGGAAAGGAGG - Intronic
1167476079 19:49701585-49701607 CGCTGCTGCAGTGGTACCTGCGG + Exonic
925204641 2:1995817-1995839 GGCTGCTGCAGGTGACGAGGTGG + Intronic
925492743 2:4413038-4413060 GGCTGCCGCAGGGGGAGAGGAGG - Intergenic
926556028 2:14359021-14359043 TGCTGTTGCAGGGGCACAGTGGG + Intergenic
927325467 2:21800310-21800332 ATCTGCTGGAGGGAAACAGGAGG + Intergenic
929043972 2:37772967-37772989 CACTGCTGGAGGGACACAGGTGG + Intergenic
931321963 2:61180588-61180610 CGCTGCTGGAGGAGAGCAGCTGG - Intronic
933646913 2:84820549-84820571 CGCTGAAGCAGGGGAATAGAGGG + Intergenic
934680022 2:96276981-96277003 CGCCACTGCAGGGGGAGAGGAGG + Exonic
937222898 2:120352354-120352376 CGATGCTGCATGGTAACAGCAGG - Intergenic
937855032 2:126666106-126666128 CGCAGCTGCTGGGACACAGGTGG - Intronic
938083713 2:128384714-128384736 CACTGCTGCAGGGAAACTGCTGG - Intergenic
939096478 2:137838575-137838597 CGCTGTTTCAGGAGAAAAGGAGG - Intergenic
939976707 2:148725961-148725983 AGCGGCTGGAGGGTAACAGGAGG - Intronic
943612204 2:190046183-190046205 CTCTCCTGGAGGGGAACAGAAGG - Intronic
947878844 2:233486931-233486953 GGCTGCTGGAGAGAAACAGGAGG + Intronic
948860281 2:240749610-240749632 GGAAGCTGCAGGGCAACAGGCGG - Intronic
1169387925 20:5166791-5166813 AGCTGCTTCAGTGGAACAGGTGG + Intronic
1170625935 20:18030217-18030239 CGCTGCTGCATGGGCCCAGAAGG - Intronic
1173813731 20:45971844-45971866 CGCCTCCGCAGGGGAACCGGGGG - Intronic
1175562304 20:59940427-59940449 CGCTGCGGCAGGGGAGCTGGAGG - Intronic
1175944095 20:62550789-62550811 CGCTGCTGCAGGAGGGCTGGGGG + Exonic
1176816765 21:13610315-13610337 CCCTGCAGCAGGGGAAGCGGTGG - Exonic
1178534927 21:33403409-33403431 CGCTGCTGCTCGGGAAGAGGCGG + Exonic
1179558303 21:42194664-42194686 GGTCCCTGCAGGGGAACAGGAGG + Intergenic
1179646534 21:42779442-42779464 CCCTGCTGCAGGGGAACGTGAGG + Intergenic
1179801981 21:43815370-43815392 CGTGGCTGCAGGGGAAAGGGGGG + Intergenic
1179893842 21:44350700-44350722 CGCTGGTGCAGGGGCACCGGTGG + Intronic
1180017600 21:45097513-45097535 CCCTGTGGCAGGAGAACAGGTGG + Intronic
1180041204 21:45281160-45281182 CGCTTCTGCCGGGGAGCAGGGGG - Intronic
1180598197 22:16993617-16993639 CACAGCTGAATGGGAACAGGTGG - Intronic
1180920702 22:19520126-19520148 CACTGAGGCAGGGGCACAGGTGG + Intronic
1181696395 22:24594896-24594918 TGAGGCTGCAGGGGAAGAGGAGG - Intronic
1183059492 22:35327377-35327399 AGCTGCTGCAGGTGAGCAGGTGG + Exonic
1183495802 22:38143093-38143115 AGGTGCTGCAGGTGAGCAGGGGG - Exonic
1183776264 22:39968153-39968175 TGCTGCTGCAGGGGAAGGGTCGG - Exonic
1185051364 22:48555929-48555951 GGCTGGGGCAGGGGAGCAGGTGG - Intronic
1203296095 22_KI270736v1_random:44362-44384 CACTGCTGGAGGGACACAGGTGG + Intergenic
949984906 3:9532950-9532972 TGCTGCTGCAGGGGCCCTGGAGG + Intronic
950504998 3:13389095-13389117 CTCTTGTGCAGGGGAACAGTGGG - Intronic
951294480 3:20917450-20917472 TGCTGTTGTAGGGGAACAGTGGG + Intergenic
951609801 3:24479423-24479445 CCTTGCTCCAGGGGAACACGGGG + Intronic
955354988 3:58223764-58223786 GGCAGCAGGAGGGGAACAGGTGG + Intergenic
957097720 3:75792399-75792421 GGCTGCTGCAGTGGGGCAGGTGG + Intergenic
959007834 3:101040503-101040525 AGCTGGTGCAGGGGAGCAGGGGG - Intergenic
959487629 3:106945680-106945702 TGCTGCTGCAGAGGAAGAGTGGG - Intergenic
961782144 3:129326597-129326619 CTCTTGTGCAGGGGAACAGTGGG - Intergenic
963960127 3:151300504-151300526 CCCAGCTGCAGGGGAAGGGGTGG - Intronic
964245057 3:154642203-154642225 AGAAGCTGCAGGGGAGCAGGAGG - Intergenic
964590590 3:158359492-158359514 GGCTGCTGCAGCAGAGCAGGTGG + Intronic
966166631 3:177026437-177026459 CACAGCTATAGGGGAACAGGTGG - Exonic
968299277 3:197600873-197600895 GGGTGCTGCAGGGGAGCAGTTGG - Intergenic
968451257 4:677085-677107 CGGTGCTGCAGGGGCAGTGGTGG - Intronic
968730190 4:2265844-2265866 TGCTGGTGCAGGGGACCTGGGGG - Intergenic
969040268 4:4290303-4290325 AGCTGCTGCAGGTGAAGAGTAGG + Exonic
969569582 4:8000753-8000775 GGCTGCTGCCTGGGAACGGGAGG + Intronic
972775790 4:42239238-42239260 CACTACTGCATGGGAAAAGGAGG - Intergenic
973218887 4:47703226-47703248 GGCTGCTGCATGGGAGCTGGTGG - Intronic
973893484 4:55390612-55390634 TGCTGGTGCAGGGGAAAGGGAGG - Intergenic
976669168 4:87632929-87632951 AGCTTATGAAGGGGAACAGGTGG + Intergenic
977092569 4:92696839-92696861 CCCTGCTGCAAGGTAACAAGAGG - Intronic
978372882 4:108046842-108046864 CGGTGCAGCTGGGGAACAGCTGG - Intergenic
981998524 4:151001287-151001309 TGCTGCTACTGGGGAACATGAGG - Intronic
983845624 4:172514422-172514444 TGCTGCTGGAGGGGCACAGCAGG - Intronic
985100157 4:186450810-186450832 GGCTGCTGCGGGGGTGCAGGGGG + Intronic
985640817 5:1062750-1062772 GGCTGCTGCAGGGGCACAGGTGG + Intronic
987318304 5:16744655-16744677 GGCTGGGGCTGGGGAACAGGTGG + Intronic
988565795 5:32319428-32319450 GGCTGCTGCAGTGGGGCAGGTGG + Intergenic
991676526 5:69094179-69094201 CGCCGCTGCCGCGGAACAGCGGG - Exonic
992027092 5:72681243-72681265 CTCTGCTGCAGGGGTGTAGGAGG + Intergenic
997509170 5:134441614-134441636 GGCTGCTGGTGGAGAACAGGTGG + Intergenic
997856007 5:137373447-137373469 GGATGCTGCAGGGGAATTGGTGG - Intronic
998713120 5:144849155-144849177 CGCTGCTGCAGGGGGTCCAGGGG + Intergenic
998861776 5:146451421-146451443 GGCTGAGGCAGGAGAACAGGAGG - Intronic
999132675 5:149296476-149296498 CGTGGCTGCAGGGCCACAGGAGG + Intronic
1000980265 5:167809428-167809450 CCATGCTGCAGGAGAGCAGGAGG + Intronic
1001004696 5:168039860-168039882 CGCTGCTGCAGGTGCACTGCAGG - Intronic
1001048983 5:168399225-168399247 CCTTGCTCCAGGGAAACAGGTGG - Intronic
1001106437 5:168858566-168858588 CGCTGCTGCAGGGGAGTTTGTGG - Intronic
1001570254 5:172726047-172726069 CCCTGCGGCTGGGGAACTGGTGG - Intergenic
1002342251 5:178524725-178524747 CCCTGCTTCAGGGGCATAGGAGG - Intronic
1006793927 6:36720475-36720497 GGCAGCTGCAGGTGACCAGGGGG + Exonic
1007678834 6:43620684-43620706 CTCTGTTGCAGGGAACCAGGAGG - Exonic
1007949760 6:45860769-45860791 AGCTGCCCCAGGGTAACAGGTGG + Intergenic
1012276646 6:97282873-97282895 CCCTGCTGCTGGGAAACGGGCGG - Intronic
1013265567 6:108494175-108494197 CACTGGGGCAGGGGAGCAGGGGG - Intronic
1015054461 6:128883134-128883156 AGCAGCTGCTGGGGAAGAGGAGG - Intronic
1018721784 6:166578377-166578399 CAATGCTGGAGGTGAACAGGTGG + Intronic
1019521462 7:1462360-1462382 CGCTGGTGCAGGGGACTGGGAGG + Intergenic
1020609567 7:10378044-10378066 TGCTGCTGCAGAGGAAGTGGAGG + Intergenic
1025753628 7:64313942-64313964 CGCAGCTACAGAGGAAGAGGCGG + Intronic
1025798124 7:64758786-64758808 CGCTGCTGCAGGGGGTCCAGGGG + Intergenic
1026459790 7:70603831-70603853 CTCTGCTTCAGAGGAACTGGGGG - Intronic
1027681883 7:81232578-81232600 CCCTGCTGCAGGTGACAAGGAGG - Intergenic
1028121435 7:87059758-87059780 CGCTGGAGCTGGGGAGCAGGTGG + Intergenic
1030348295 7:108456591-108456613 CGCAGCAGCAGGGCAAGAGGGGG - Intronic
1030585554 7:111414191-111414213 TCTTCCTGCAGGGGAACAGGAGG - Intronic
1032281637 7:130507742-130507764 TGCTGCTGCTTGGGAAGAGGTGG - Exonic
1033415995 7:141161627-141161649 GGCTCTTCCAGGGGAACAGGTGG + Intronic
1034531157 7:151697173-151697195 AGCAGCTGCTGGGGAACGGGGGG + Intronic
1036749315 8:11434066-11434088 CGCTGCTGAAGGGCAACTGGAGG + Exonic
1037334077 8:17775088-17775110 GGCTGGGGCAGGGGAACATGGGG + Intronic
1038134122 8:24767409-24767431 TGCTGCTGTTGGGAAACAGGGGG - Intergenic
1038430219 8:27493994-27494016 CGCTGCTGCAGGGGGTCCAGGGG + Intronic
1040470008 8:47729131-47729153 CGCCTCTGCAGGCGTACAGGAGG - Intronic
1040551070 8:48437993-48438015 CGGAACTGCAGGGGAACAGAAGG - Intergenic
1042920175 8:73912450-73912472 CGCTGCTGCAGGGGCTCCAGGGG - Intergenic
1044004800 8:86927322-86927344 CGCTGCTGCAGGGGGTCCAGGGG + Intronic
1047294818 8:123561466-123561488 AGCTTCTGCAGGGGAACCTGAGG + Intergenic
1047961702 8:130016195-130016217 CGCTGCGGCGGGTGGACAGGGGG - Intronic
1048317960 8:133375776-133375798 AGCTGCTGCAGGGGTGCACGTGG - Intergenic
1048866209 8:138763650-138763672 CGCAGCTGCTGGGGTGCAGGTGG - Intronic
1048995264 8:139790052-139790074 CGCTGCTGAGCGGGAACAGCAGG + Intronic
1049002744 8:139836536-139836558 CATTGCTGCAGGGGAGCAGTTGG - Intronic
1049232343 8:141490940-141490962 CTCTGAGGCAGGTGAACAGGAGG + Intergenic
1049418920 8:142508283-142508305 CCATGCTGGAGAGGAACAGGTGG - Intronic
1049574063 8:143382425-143382447 CCCTGCTGCAGGGGGACCGCCGG + Exonic
1052057061 9:23918150-23918172 TGCTGCTGCAGGGGATCCAGGGG + Intergenic
1053052769 9:34975824-34975846 AGCTGCTGCAGGGAATAAGGGGG - Intronic
1056392046 9:86149574-86149596 CGCTGCTGCAGGGGGTCCAGGGG + Intergenic
1057253518 9:93524018-93524040 TGCTGGTGCAGGGCAACAGAAGG - Intronic
1057560334 9:96123165-96123187 TGCTGCTGCAGGGGACATGGAGG - Intergenic
1057877246 9:98767438-98767460 GGATGCTGTAGGGGCACAGGTGG - Intronic
1059564781 9:115373105-115373127 AACTGCTGCAGGCAAACAGGTGG - Intronic
1060495271 9:124113630-124113652 AACTGCTGCATGGGAGCAGGAGG + Intergenic
1061194907 9:129102343-129102365 CCCTGCTGCAGGAGTACAGCCGG - Intronic
1061595721 9:131628003-131628025 TGCTGCTGCAGGGGGAGAGGCGG + Exonic
1061747302 9:132749863-132749885 CGCTGCTGCAGGAGGCCATGGGG + Intronic
1061762561 9:132860532-132860554 GGCTGCTGCTGGGGAGCTGGAGG + Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062440064 9:136565811-136565833 CCGTCCTGCAGGGGAAGAGGTGG + Intergenic
1062489934 9:136800159-136800181 GGCTGCTGCAGGTGGAGAGGCGG + Exonic
1203530596 Un_GL000213v1:139179-139201 CCCTGCAGCAGGGGAAGCGGTGG + Intergenic
1203688887 Un_GL000214v1:23526-23548 GGCTGCTGCAGTGGGGCAGGTGG - Intergenic
1203647388 Un_KI270751v1:80527-80549 GGCTGCTGCAGTGGGGCAGGTGG + Intergenic
1195926502 X:110031047-110031069 GGCAGTTGCAGGGGAAGAGGAGG - Intronic
1198479853 X:137031320-137031342 CGCTGGCGAAGGCGAACAGGTGG + Exonic
1201180035 Y:11334097-11334119 GGAGGCTGCAGGGGCACAGGCGG - Intergenic
1201337129 Y:12893201-12893223 GGCTGCTGCAGGGCATAAGGAGG - Intergenic