ID: 1124245647

View in Genome Browser
Species Human (GRCh38)
Location 15:28069442-28069464
Sequence GCCCCGCATGAGAGGGAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 2, 1: 3, 2: 0, 3: 13, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124245647_1124245652 7 Left 1124245647 15:28069442-28069464 CCGGTCTCCCTCTCATGCGGGGC 0: 2
1: 3
2: 0
3: 13
4: 170
Right 1124245652 15:28069472-28069494 GGACTGTACTGCTGCCATCTCGG 0: 791
1: 492
2: 154
3: 345
4: 7246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124245647 Original CRISPR GCCCCGCATGAGAGGGAGAC CGG (reversed) Intronic