ID: 1124245647 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:28069442-28069464 |
| Sequence | GCCCCGCATGAGAGGGAGAC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 188 | |||
| Summary | {0: 2, 1: 3, 2: 0, 3: 13, 4: 170} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1124245647_1124245652 | 7 | Left | 1124245647 | 15:28069442-28069464 | CCGGTCTCCCTCTCATGCGGGGC | 0: 2 1: 3 2: 0 3: 13 4: 170 |
||
| Right | 1124245652 | 15:28069472-28069494 | GGACTGTACTGCTGCCATCTCGG | 0: 791 1: 492 2: 154 3: 345 4: 7246 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1124245647 | Original CRISPR | GCCCCGCATGAGAGGGAGAC CGG (reversed) | Intronic | ||