ID: 1124247486

View in Genome Browser
Species Human (GRCh38)
Location 15:28083514-28083536
Sequence ACTTTGTTCTTACCAGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124247486 Original CRISPR ACTTTGTTCTTACCAGGTAG TGG (reversed) Intronic
901506133 1:9687322-9687344 TCATTGTACTTACCAGGTTGGGG + Intronic
905330792 1:37195296-37195318 ACTTTCTTGTTACCAGTAAGAGG - Intergenic
906418524 1:45642367-45642389 AATTTTTTCTTAGCAGGGAGGGG - Intronic
912095719 1:106140427-106140449 ACTATGTTCTTTCCAGTTTGGGG - Intergenic
912247904 1:107979979-107980001 GTGCTGTTCTTACCAGGTAGGGG - Intergenic
919545119 1:198906534-198906556 ATTTTATTCCTACCAGGTATTGG - Intergenic
1062841153 10:673036-673058 CCTTGGTTCTAACCAGGTACAGG - Intronic
1069995587 10:72340465-72340487 ACTTTGGCCTTACCAGCGAGCGG + Intronic
1072413239 10:95224912-95224934 ACTTTGTACTAACCAGGCAATGG + Intronic
1074703578 10:116112529-116112551 GCTTTTCTCTTACCAAGTAGGGG - Intronic
1074903861 10:117843134-117843156 ACTTTTTTTTTTCCAGGTAAGGG - Intergenic
1081502132 11:43677323-43677345 AATTTGTTCTTAGCCAGTAGGGG - Intronic
1086931188 11:92694860-92694882 ACTTTCTTCTCACAAGGCAGGGG - Intronic
1087351246 11:97035578-97035600 ACTTTATTCTTAATAGGTACAGG + Intergenic
1089535439 11:119158218-119158240 AATTTCTTCTTCCCAGGAAGTGG + Exonic
1089919977 11:122199888-122199910 ACTTTATTTATAACAGGTAGTGG + Intergenic
1092097185 12:5852519-5852541 ACTTTATTCTTCTCAAGTAGAGG + Intronic
1092299855 12:7237052-7237074 ACTTTGTACTAACCAGGCACTGG + Intergenic
1098212900 12:68185308-68185330 ATTTTGTTCTTGCTAGGTAATGG - Intergenic
1099206073 12:79727855-79727877 ACCTCATTATTACCAGGTAGGGG - Intergenic
1103358978 12:120342552-120342574 ACTTTGTTCTCAGCTGGTGGGGG + Exonic
1103410705 12:120710027-120710049 ACTTTGGTCCTGCCAGGTGGAGG - Intergenic
1103891463 12:124242054-124242076 TCTTTGTTTTGACCAGGCAGAGG - Intronic
1104087426 12:125489033-125489055 ATTTTGTTTTTACCAGATACTGG + Intronic
1113738066 13:112691664-112691686 ACTTTGTTCTTTCCCGGCATAGG + Intronic
1116596779 14:46858746-46858768 ACTTTGGACTTAGCAGATAGAGG - Intronic
1118423015 14:65628335-65628357 ACTTTGTTCTTAACATGAATTGG - Intronic
1124247486 15:28083514-28083536 ACTTTGTTCTTACCAGGTAGTGG - Intronic
1124388858 15:29235029-29235051 ATTCTCTTCTTCCCAGGTAGTGG + Intronic
1125831597 15:42720618-42720640 ACTTTGTGTTTACCTGGAAGTGG + Exonic
1131700446 15:94929724-94929746 ACTGTGATCTTACCAGGGAATGG - Intergenic
1141593045 16:85081383-85081405 ACTTTGCTCCTACCTGGTAGTGG - Exonic
1141909438 16:87048388-87048410 ACATTGTTCTTTCCAGGGATGGG + Intergenic
1143956839 17:10676994-10677016 GCTTTTTACTTACCAGTTAGGGG - Exonic
1145097601 17:20044281-20044303 AGGCTGTTCTTACGAGGTAGTGG + Intronic
1146532369 17:33619862-33619884 AATCTGTTCTTTCAAGGTAGAGG + Intronic
1149974014 17:61247981-61248003 ACTTTGTTCCTACCAGTTGTGGG + Intronic
1151369752 17:73640343-73640365 ACTCTGTTCCTCCCAGGCAGGGG + Intronic
1156192911 18:34740409-34740431 GCTGTGTTCTTACCAGGTTGAGG + Intronic
1156655644 18:39282758-39282780 ACTTTCTTCTTTCAATGTAGGGG + Intergenic
1160175026 18:76586289-76586311 ACTATGTTGTTACCAGAAAGGGG - Intergenic
1167489130 19:49781747-49781769 TCTTTGCTCTTACCTGGGAGAGG - Exonic
1168465299 19:56596592-56596614 ACTCTGTTCTGACCAAGGAGAGG + Intronic
1168580635 19:57553057-57553079 GCTGTGTTCTTACAAGGTGGAGG - Intronic
925681487 2:6426520-6426542 TCTTTGTTCTTACTAGAAAGAGG - Intergenic
927740976 2:25569417-25569439 ACTCTCTTATTTCCAGGTAGAGG + Intronic
928565625 2:32545197-32545219 ACTGTGTTCTAGCCAGGAAGGGG - Intronic
931455787 2:62408959-62408981 ACTCTGTTTTAGCCAGGTAGGGG - Intergenic
934941925 2:98509002-98509024 ACTCTGTCCTTTCCAGGCAGCGG - Intronic
936666770 2:114605971-114605993 GCCTTGTTCATAACAGGTAGTGG - Intronic
937962454 2:127470712-127470734 ACTTTGTGCCTACCAGGTGTTGG - Intronic
938775421 2:134537407-134537429 ACTGTGTCCTTACAAGGCAGGGG + Intronic
938950377 2:136249543-136249565 ACTTAGCCCTTACCAAGTAGAGG - Intergenic
940613172 2:156016327-156016349 ACTGTGTCCTCACAAGGTAGGGG + Intergenic
943167235 2:184345349-184345371 TTTTTGTACATACCAGGTAGAGG + Intergenic
944934055 2:204549055-204549077 TCTTTGTTCTCAACAGGTAGTGG - Intronic
945071166 2:205990430-205990452 ACTGTGTTCTCACCTGGCAGAGG - Intergenic
945886923 2:215385696-215385718 TCATTGTTCTTAGCAGATAGAGG - Intronic
947622487 2:231599558-231599580 ACCTTGTCCATACCAGGAAGGGG + Intergenic
947949530 2:234135369-234135391 ACTTTGCTCTCACCAGGCTGAGG - Intergenic
948979137 2:241483912-241483934 TCCTTGTTCCTACCAGTTAGTGG + Intronic
1173131030 20:40393735-40393757 TCTGTGTTCTTCCCAGGGAGAGG - Intergenic
1175041873 20:56059663-56059685 AGTGTGTTCTTACAAGGTAAAGG - Intergenic
1175663993 20:60842962-60842984 ATTTTGTTCTTACTTGGTACTGG + Intergenic
1178505504 21:33159507-33159529 CCATTCTTCCTACCAGGTAGTGG - Intergenic
1180883035 22:19219950-19219972 CCTTTCTGCATACCAGGTAGCGG + Exonic
1181644814 22:24225533-24225555 GCTTTGTTCTCACCAGGTGAGGG + Exonic
1182468953 22:30535358-30535380 ACTTGGTTCTCACCAGCCAGAGG - Intronic
1183059524 22:35327568-35327590 ACTTTGTTCAAACCAGAAAGTGG - Intronic
949575008 3:5330715-5330737 CCTTGGCTCTGACCAGGTAGAGG - Intergenic
951952730 3:28218816-28218838 ACCTTGTGCTTACCAGATAGAGG - Intergenic
957077382 3:75612451-75612473 ACATTGTTCTTAATAGGCAGCGG - Intergenic
957380949 3:79428701-79428723 AATTGGTTGTTACCAGGTGGAGG - Intronic
964822343 3:160785803-160785825 ATTTTGTTCTTACAAGACAGCGG + Intronic
965075846 3:163974392-163974414 TTTTTGTCCTTACCAGGTTGTGG - Intergenic
965666592 3:171100634-171100656 ACCTTGTGCTTACTAGGTGGAGG + Intronic
965734718 3:171808685-171808707 ACTTACTTATAACCAGGTAGTGG - Intronic
970767054 4:19562495-19562517 ACTTTGATCTTACCATGTTAAGG + Intergenic
970786786 4:19806887-19806909 ACCTTATTCTGACCATGTAGTGG - Intergenic
970834111 4:20380116-20380138 ACTTTGTTCTTACCAGCAATAGG + Intronic
970947251 4:21709280-21709302 AGTTTCTACTTACCAGGTAGAGG + Intronic
972616808 4:40706178-40706200 ACTTTCATCTTACCATGTACAGG - Intergenic
973695231 4:53484042-53484064 ACTTTGTCCTTACATGGTAGAGG - Intronic
973873378 4:55188879-55188901 GCTTTGTTATTGCCAGGTGGAGG - Intergenic
975282221 4:72574063-72574085 ACTTTGTTCTTGCAAGATAATGG - Intergenic
977894942 4:102352728-102352750 ACTTTCTTCTCATCAGGTACAGG - Intronic
978789850 4:112650556-112650578 ACTTGTTTCCTGCCAGGTAGAGG - Exonic
979733436 4:124052705-124052727 ACTTTGTTTTTACCATCTTGAGG + Intergenic
980487190 4:133473945-133473967 ACTTTGTTCATACCAATTATTGG + Intergenic
981766150 4:148252412-148252434 ACTGAGTACTTACCAGGTACAGG - Intronic
983795316 4:171854733-171854755 ACTGTGTTCTTACATGGTGGAGG + Intronic
985987586 5:3529660-3529682 ACTTCCTTCTTCCCAGGCAGAGG + Intergenic
988634898 5:32972103-32972125 ACTTTGTTCTCACCTTATAGAGG - Intergenic
992777908 5:80104455-80104477 ACATGGGTCTTACCAGGTGGTGG + Intergenic
995963712 5:117877699-117877721 AATTTATTCTTACAAGGTACTGG + Intergenic
996647919 5:125839853-125839875 ACTTTATTATTTCCAGGTTGAGG + Intergenic
998507173 5:142681420-142681442 AGGTTTTTCTGACCAGGTAGTGG - Intronic
998569475 5:143244500-143244522 ACTTTGCTCTTAACATGCAGAGG - Intergenic
1001248587 5:170125564-170125586 AATTTGATCTTACCAGATATGGG - Intergenic
1003981610 6:11395390-11395412 ACTCTGTGCTTACTAGGGAGCGG - Intergenic
1004823826 6:19399153-19399175 ATTCTGTTCTTACCAGGCAGTGG - Intergenic
1007759003 6:44121278-44121300 ACTTAGTGCTGACCAGGAAGTGG - Intronic
1008326880 6:50192925-50192947 ACTTGGTTTTTACCTGGTGGTGG + Intergenic
1010351113 6:74875120-74875142 AGCTTGTTCTTAACAGATAGCGG - Intergenic
1010383704 6:75253402-75253424 CATTTGTTCTTACCAGGAAGTGG - Exonic
1010654348 6:78494470-78494492 ACTGTGTTCTCACATGGTAGGGG + Intergenic
1013573278 6:111451736-111451758 CCTCTGTTCTTACCAGATTGTGG - Intronic
1021869202 7:24986880-24986902 ACTTTGTTCCTTCCAGGCATGGG + Intergenic
1022229833 7:28404052-28404074 ATTTTGTTCTTACCAGAACGTGG + Intronic
1022270458 7:28802326-28802348 TTTTTTTTCTTAGCAGGTAGAGG + Intronic
1023871085 7:44263418-44263440 AATTTGTTCTTCCGAGGCAGGGG + Intronic
1024405510 7:48975005-48975027 ACTTTGTACTAACCAGGCACTGG - Intergenic
1024579478 7:50790402-50790424 ACTTTTTTTTTTCCTGGTAGTGG - Intronic
1027440695 7:78216436-78216458 ACTTTGTTCTTACAAGCATGGGG - Intronic
1030003074 7:105086248-105086270 ACTATGTTCCTACCATGGAGAGG - Intronic
1030633813 7:111925635-111925657 ACTTTGGTCCTACTGGGTAGAGG - Intronic
1030877985 7:114839385-114839407 GTTTTGTTTTTACCAGGCAGAGG - Intergenic
1031634035 7:124080288-124080310 ACTTTATTCTTATGAGGCAGTGG - Intergenic
1032353341 7:131186211-131186233 CCTCTGTTCTGACCAGGTATGGG + Intronic
1036687556 8:10922026-10922048 ACTGTGTTCTTACATGGCAGAGG - Intronic
1038534819 8:28346494-28346516 GCTTTGTTCTTACTAGGTTTTGG - Exonic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1040756707 8:50784007-50784029 ATGTTGTTCTTGCCAGATAGGGG + Intronic
1041973253 8:63767769-63767791 ACCTTGTTACTACCAGGTGGAGG + Intergenic
1043158966 8:76821746-76821768 TTTTTGTTTTTACCAGGTACTGG + Intronic
1043722279 8:83559731-83559753 CCTTTGTTCTTTTCAGGTACTGG - Intergenic
1044653393 8:94522723-94522745 ACTTTGCCCTTAACAGGTAATGG - Intronic
1045406919 8:101875764-101875786 TCTTTGTCCTTCCCAGGGAGGGG - Intronic
1048889149 8:138932493-138932515 ATTTTGGTCTGACCAGGCAGTGG + Intergenic
1052332997 9:27289659-27289681 ATTTTGTTCTTACCTGGAATTGG + Exonic
1052501605 9:29298722-29298744 ACTTTGTTCTGAGGAGGTGGGGG + Intergenic
1055692775 9:78851699-78851721 ACTTTGTTACTTCCAGGTAGAGG + Intergenic
1057287043 9:93765120-93765142 TCTTTGTCCTTACCTGGTGGCGG + Intergenic
1057503579 9:95615091-95615113 ACTTTGTTCTCACCTAGAAGGGG + Intergenic
1187329488 X:18323846-18323868 ACTTTCTTCTTACCTAGTGGAGG + Exonic
1189526455 X:41827444-41827466 ACTGTGTCCTTACATGGTAGTGG + Intronic
1198955638 X:142126401-142126423 ACTTTGTTCTCAGCAAGAAGGGG - Intergenic
1201356832 Y:13105334-13105356 AATTTGTCCTCAACAGGTAGAGG + Intergenic