ID: 1124249330

View in Genome Browser
Species Human (GRCh38)
Location 15:28096865-28096887
Sequence GCAGGCCAGGCGCACCTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 170}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124249318_1124249330 1 Left 1124249318 15:28096841-28096863 CCCCCCGGGACTGGCGGCCCCGC 0: 1
1: 0
2: 4
3: 34
4: 234
Right 1124249330 15:28096865-28096887 GCAGGCCAGGCGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 15
4: 170
1124249312_1124249330 22 Left 1124249312 15:28096820-28096842 CCGAGGGCCGCGTTCGCAGGGCC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1124249330 15:28096865-28096887 GCAGGCCAGGCGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 15
4: 170
1124249322_1124249330 -2 Left 1124249322 15:28096844-28096866 CCCGGGACTGGCGGCCCCGCGGC 0: 1
1: 0
2: 0
3: 27
4: 230
Right 1124249330 15:28096865-28096887 GCAGGCCAGGCGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 15
4: 170
1124249314_1124249330 15 Left 1124249314 15:28096827-28096849 CCGCGTTCGCAGGGCCCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1124249330 15:28096865-28096887 GCAGGCCAGGCGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 15
4: 170
1124249319_1124249330 0 Left 1124249319 15:28096842-28096864 CCCCCGGGACTGGCGGCCCCGCG 0: 1
1: 0
2: 1
3: 16
4: 125
Right 1124249330 15:28096865-28096887 GCAGGCCAGGCGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 15
4: 170
1124249320_1124249330 -1 Left 1124249320 15:28096843-28096865 CCCCGGGACTGGCGGCCCCGCGG 0: 1
1: 0
2: 2
3: 24
4: 164
Right 1124249330 15:28096865-28096887 GCAGGCCAGGCGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 15
4: 170
1124249323_1124249330 -3 Left 1124249323 15:28096845-28096867 CCGGGACTGGCGGCCCCGCGGCA 0: 1
1: 0
2: 3
3: 12
4: 141
Right 1124249330 15:28096865-28096887 GCAGGCCAGGCGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124249330 Original CRISPR GCAGGCCAGGCGCACCTCTC GGG Intronic