ID: 1124249535

View in Genome Browser
Species Human (GRCh38)
Location 15:28097759-28097781
Sequence TCCCAGTTGGTGATGGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124249535_1124249544 14 Left 1124249535 15:28097759-28097781 CCATCACCCATCACCAACTGGGA 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1124249544 15:28097796-28097818 TCACCAGTGCTTCCCTGCCCCGG 0: 1
1: 0
2: 2
3: 19
4: 256
1124249535_1124249546 19 Left 1124249535 15:28097759-28097781 CCATCACCCATCACCAACTGGGA 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1124249546 15:28097801-28097823 AGTGCTTCCCTGCCCCGGCCTGG 0: 1
1: 0
2: 3
3: 25
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124249535 Original CRISPR TCCCAGTTGGTGATGGGTGA TGG (reversed) Intronic
900022395 1:193973-193995 TCCCAGTTGGTGACAGAAGAGGG + Intergenic
900231569 1:1561563-1561585 TCCTGGTTAGTGATGGGTGCAGG - Intronic
901136472 1:7000067-7000089 TACCAGCTGGTGCTGGGTGAGGG + Intronic
903473506 1:23603890-23603912 ACTCCGTTGGTGGTGGGTGAGGG - Intronic
904621515 1:31778148-31778170 TCACTTTTGGTGCTGGGTGAAGG - Intergenic
904820363 1:33239012-33239034 TCCCAGAAGGTGCTGGTTGAGGG + Intergenic
904908674 1:33917510-33917532 TCTCAGTTGTTGATGGGTTAGGG - Intronic
905291451 1:36924407-36924429 TCCAAGGTGCTGATGGCTGAGGG + Intronic
905771434 1:40640468-40640490 TCCCAGTTGGGGCTGGGGGTGGG - Intronic
906290975 1:44619004-44619026 TCTGGGTTGGTGATGGGGGAGGG + Intronic
906780619 1:48569802-48569824 TCCCATTTGGTGATGGCGGAGGG - Intronic
907837409 1:58123424-58123446 TTCCAATTGGTGATGGGGGCAGG + Intronic
912366537 1:109138279-109138301 TGACACTTGGTGATGGCTGAGGG + Intronic
912769313 1:112448292-112448314 ACTCAGTTGTTGATGGGTCAAGG - Intronic
912934712 1:113993250-113993272 TCACAGACGGTGGTGGGTGAGGG - Intergenic
914703314 1:150152028-150152050 TCCCAGTTAGCCCTGGGTGAGGG - Intronic
916002871 1:160633485-160633507 TCCCAGGTGGTCATGGTTGAGGG - Intronic
916568923 1:166008300-166008322 CCCCAGTGGGTGGTGGGTGGAGG + Intergenic
918306627 1:183252417-183252439 TCCGGGTTGGGGGTGGGTGAGGG - Exonic
918414353 1:184291273-184291295 CCCCTGTAGGTGCTGGGTGATGG + Intergenic
918597224 1:186307373-186307395 TCCTTGGTGGTGGTGGGTGAAGG - Exonic
922962528 1:229661171-229661193 TCACAATTGGAGATGGGTGTTGG + Intergenic
922986857 1:229872731-229872753 TCTCTGGTGGTGATCGGTGAAGG - Intergenic
1064565304 10:16633433-16633455 CCCCAGGTGGGGATGGGTGTTGG - Intronic
1065755928 10:28931079-28931101 GCCCAGTTGGTAATGGGAAAAGG + Intergenic
1065953418 10:30673043-30673065 TCCCAGTTCCTGATGGGCCAGGG - Intergenic
1066493197 10:35915006-35915028 TCATAGTTGGGGATGGGAGAAGG - Intergenic
1067054388 10:43042587-43042609 GCCCACTGGGAGATGGGTGAGGG - Intergenic
1068604068 10:58986292-58986314 TGCCAACTGGTGAAGGGTGATGG + Intergenic
1068798585 10:61113367-61113389 TGCTAGTTGATAATGGGTGAAGG + Intergenic
1071149162 10:82613151-82613173 TCCCAGTTAGTCTTGGGAGATGG + Intronic
1072590902 10:96827664-96827686 TCGCAGTTGGTGGTGGTTGGGGG + Intergenic
1073067813 10:100774252-100774274 TCCAAGTTGGTGAGAGGTGGGGG + Intronic
1073073006 10:100806508-100806530 TTCCAGCTGCTGCTGGGTGAAGG - Exonic
1073379895 10:103070134-103070156 TCACAGTGGGTGTTGGGTGTTGG - Intronic
1074102707 10:110366116-110366138 ACCCAGTTCCTGCTGGGTGAAGG - Intergenic
1074187611 10:111110529-111110551 TCCCAGCTAGGGATGGGTGAGGG - Intergenic
1074365756 10:112856280-112856302 TTGAAGTTGGAGATGGGTGAGGG - Intergenic
1075864561 10:125706517-125706539 TCGCTGTTGATGGTGGGTGATGG + Intergenic
1076133507 10:128029351-128029373 TCACAGTGGGTGCTGGGTCAGGG - Intronic
1076558827 10:131347779-131347801 TCCCAGAAGCTCATGGGTGAGGG - Intergenic
1076635577 10:131880148-131880170 ACCCAGGTGCTGATGGGTGGGGG + Intergenic
1076880787 10:133238185-133238207 TCCCAGGTGGAGATGGGAGTGGG + Intronic
1077229072 11:1450592-1450614 TGCCCCTTGGTGAGGGGTGAGGG - Exonic
1079727346 11:23892187-23892209 TCCCAGTTGGTGACCGGCGCTGG + Intergenic
1081688339 11:45058094-45058116 TTCCAGTTGCTGCTGGGTGATGG + Intergenic
1085646540 11:78227233-78227255 TGCCATTTGGAGATGGGGGACGG - Intronic
1087762833 11:102120596-102120618 TCTCAGTTGGGGGTGGGTGAGGG + Intronic
1090360294 11:126167646-126167668 AACCAGTGGGTGAGGGGTGAGGG - Intergenic
1091548075 12:1517777-1517799 TCCCAGTTTGTGGTAGGTGGAGG + Intergenic
1094046086 12:26168426-26168448 CCCCGGTTGGGGATGGGGGATGG + Intronic
1096472227 12:51886843-51886865 TGCCAGTTGGTAAAGGGTGGAGG + Intergenic
1097193957 12:57233666-57233688 AGCCAGCAGGTGATGGGTGAGGG + Intronic
1098084623 12:66829306-66829328 TCCCAGTTTTTGATGGCTGCTGG - Intergenic
1099487787 12:83249555-83249577 TCCCAGTTGGGGCTCTGTGAGGG - Intergenic
1099728804 12:86470456-86470478 TCACATTTGGTGTTGGGGGAAGG - Intronic
1100661907 12:96708507-96708529 TCACATTTGGTGTTGGATGAAGG - Intronic
1102202383 12:111066581-111066603 ACCCATTGGGTGAGGGGTGAGGG + Intronic
1104381632 12:128312647-128312669 TCCCAGTTCCTGATGGCTGTTGG - Intronic
1105037111 12:132933580-132933602 GCCCAGTTGGTTCTGGTTGAGGG - Intronic
1106131999 13:26948585-26948607 TTCCAGAGGGTGAGGGGTGAGGG - Intergenic
1110337040 13:74345192-74345214 GGCCAGTTGGTGATGGTTGCAGG + Intergenic
1110950506 13:81483392-81483414 GGCAAGGTGGTGATGGGTGATGG + Intergenic
1115344810 14:32331048-32331070 TGCTAGATGGTGATGGGGGAAGG + Intronic
1119635654 14:76271204-76271226 TCCCAGCCAGTGAGGGGTGATGG - Intergenic
1120458142 14:84758490-84758512 TCCCAGCAGATGATGGGTAATGG - Intergenic
1120638472 14:86980711-86980733 AACCTGTTGGTGGTGGGTGATGG + Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1121261339 14:92568622-92568644 GCCCAGGTGGCCATGGGTGAGGG - Intronic
1121847759 14:97188219-97188241 TCCCAGTTGGTGAGGAGGGGTGG + Intergenic
1122856144 14:104561092-104561114 AGCCAGGTGGGGATGGGTGAGGG + Intronic
1122921671 14:104882870-104882892 TCCCAGAGGGTGGTGTGTGAAGG + Intronic
1123988231 15:25663925-25663947 GCCCAGGTGATGATGGTTGATGG + Intergenic
1124249535 15:28097759-28097781 TCCCAGTTGGTGATGGGTGATGG - Intronic
1124385592 15:29206003-29206025 TCCCTGCTGGTGGTGGGAGAGGG + Intronic
1126837500 15:52681611-52681633 TCCTAGTTGGTGAAGGGTAAGGG + Intronic
1127365114 15:58282277-58282299 TGGCAGTTGGTGCTGGCTGATGG + Intronic
1128019148 15:64375052-64375074 TCCTAGTTGGTTCTAGGTGATGG + Intronic
1128983694 15:72203999-72204021 TCTCAGTAAATGATGGGTGAGGG + Intronic
1132109935 15:99095589-99095611 TCCCAGTTCGTTAAGTGTGAAGG - Intergenic
1132390526 15:101435082-101435104 TCCCAGCTGGGGATGGGAGGGGG - Intronic
1132714577 16:1284363-1284385 GCACAGATGGTGATGGGGGAGGG + Intergenic
1137249179 16:46730188-46730210 GCCCAGGTGGTGTGGGGTGAGGG - Intronic
1137249194 16:46730234-46730256 GCCCAGGTGGTGTGGGGTGAGGG - Intronic
1138185035 16:54970345-54970367 TCACAGTGAGTGATGGGTGCTGG + Intergenic
1138650541 16:58458558-58458580 ACCCAGTTGGTGCTGAGTCAAGG - Intergenic
1139688487 16:68622966-68622988 TCACATCTGGTGATGGGTGTTGG - Intergenic
1144275684 17:13666350-13666372 TCCCAGATGGTGAGGGTTGGGGG + Intergenic
1145414451 17:22703460-22703482 CCCCAGTTGGTGCTGGGGGAAGG + Intergenic
1148805232 17:50260631-50260653 TGCCAGTGGGTGCTGGGTGCTGG + Intergenic
1148875014 17:50681905-50681927 TCCCAGACAGTGAGGGGTGAGGG - Intronic
1148901755 17:50883923-50883945 CCCCAGTGGGTGCAGGGTGACGG - Intergenic
1149523191 17:57334064-57334086 CCCCGGTTGGGGATGGGGGAAGG - Intronic
1152181155 17:78822592-78822614 TCCCAGTTAGTGAGCGGTGCGGG - Intronic
1152447183 17:80352606-80352628 TCACAGTTAGTGAGGGGTGGGGG - Intronic
1152813460 17:82393210-82393232 TCCCACTTGGTGACGGTCGATGG - Intronic
1153666390 18:7370578-7370600 TCCCAGCTGCTGATGGGAGGGGG + Intergenic
1153766074 18:8376232-8376254 ACGCAGTGGGTGATGGGTGCAGG + Intronic
1153841112 18:9008860-9008882 TCTCAATTAGTGAGGGGTGAGGG + Intergenic
1156039375 18:32803164-32803186 ACCAAGATGGTGATGGGGGAGGG - Intergenic
1156521372 18:37724717-37724739 CCTCAGTTGGTGCTGGCTGAAGG + Intergenic
1158894690 18:61901711-61901733 TCCCAGTGGGTGAAGTGTGCTGG + Intergenic
1161302170 19:3548002-3548024 TCCCTGCTGGTGGTGGGTGTCGG - Exonic
1164673005 19:30083432-30083454 TCCCAGACGTTGGTGGGTGAGGG + Intergenic
1165205942 19:34186249-34186271 GCCCAGGTGGAGTTGGGTGATGG + Intronic
927244027 2:20942536-20942558 TACCAGCTAGTGATGGGTGGTGG + Intergenic
927441549 2:23121996-23122018 TCACAGTTGGTGAGTGGTGGCGG + Intergenic
929533276 2:42765188-42765210 TCCCATTTGGTCAAGGCTGAGGG + Intergenic
929718410 2:44337963-44337985 TCCCTGTTGGGGATGTGGGATGG + Intronic
929977709 2:46651517-46651539 GCCCAGTGGGTCATGTGTGAAGG + Intergenic
936257839 2:110932734-110932756 TCCCACTTTGTGCTGGGTCAAGG + Intronic
938579835 2:132635937-132635959 GCCGATTTGGTGCTGGGTGAGGG - Intronic
940800825 2:158130821-158130843 TCACAATTGGGGATGGGTGTTGG - Intronic
943587041 2:189753082-189753104 TCCCATTTTGAGATGGGTAATGG + Intronic
943623055 2:190170578-190170600 TCCTGGTTGGGGATGGGGGATGG - Intronic
944367817 2:198944987-198945009 ACCCCGTTGGTGATGGTTCATGG + Intergenic
945024330 2:205605970-205605992 ACCCAGTTGGTGAGGAGGGATGG + Intronic
945321238 2:208425833-208425855 TCCAAGTTGGGGATGTATGAGGG + Intronic
948635028 2:239329336-239329358 TCTCTTTTGGTGATGAGTGATGG - Intronic
1169072191 20:2739386-2739408 TCCAATTTGGTCTTGGGTGATGG - Intronic
1170120615 20:12907575-12907597 TCCAAGTTGGGAATGTGTGATGG - Intergenic
1170377507 20:15717007-15717029 TCTCAGTTGGTGCTGGTTCATGG - Intronic
1172894693 20:38292293-38292315 ACACAGTTGCTGATGGCTGAAGG - Intronic
1173236461 20:41250161-41250183 TCCCTGTTGGTGCTGTCTGATGG - Intronic
1173297447 20:41772145-41772167 TCCCAGTAGCTGAGGGATGATGG - Intergenic
1176970301 21:15257394-15257416 TCTCATTTGCTGATGGTTGAGGG + Intergenic
1177471367 21:21564406-21564428 TCACAGATGGAGATGAGTGAAGG - Intergenic
1179101577 21:38359341-38359363 GCTGAGGTGGTGATGGGTGAGGG + Intergenic
1179938196 21:44618585-44618607 ACCCAGCTGGGGATGGGGGATGG - Intronic
1181322372 22:22018130-22018152 TACCAGTGACTGATGGGTGAGGG - Intergenic
1181475721 22:23166796-23166818 TTCCAGTGGGTGGTGGGTGGTGG - Intergenic
1182304973 22:29361695-29361717 TTCCATTTAGTGCTGGGTGATGG + Intronic
1185258993 22:49851334-49851356 TCCCAGTTGATGCTGGGTCCTGG + Intergenic
949436782 3:4038307-4038329 CCCTGCTTGGTGATGGGTGATGG + Intronic
949940745 3:9152329-9152351 TCCAAGGTGGAGATGGGAGAGGG + Intronic
951956838 3:28265967-28265989 TCCCAGCTGGTAATGGTTGAAGG - Intronic
953560062 3:43981539-43981561 TACCAGAGGGTGAAGGGTGAGGG - Intergenic
953567479 3:44045127-44045149 GGCCAGGTAGTGATGGGTGAGGG - Intergenic
954705171 3:52476387-52476409 TCCCAGTGAGTGTTGCGTGAGGG + Intronic
956508321 3:69967079-69967101 TGTGAATTGGTGATGGGTGATGG + Exonic
961243170 3:125429886-125429908 TCACATTTGGTGCTGGCTGATGG - Intergenic
962883181 3:139598512-139598534 TGGCAGTTGGTGCTGGGTGTTGG - Intronic
965830342 3:172779328-172779350 TCCCAGTTCTTGATGTGTGTGGG + Intronic
968138045 3:196233262-196233284 TCCCATTTGGTCAAGGTTGAGGG - Exonic
968377039 4:52329-52351 TCCCAGTTGCTGTTTGGTGGAGG - Intergenic
969038939 4:4278629-4278651 TCCCAGGTGGTGGTGCATGAGGG - Intronic
969483625 4:7459746-7459768 TCCCAGAGGGTGATGGGAGCAGG - Intronic
970435270 4:16027566-16027588 TCCCTCTTGGGGATGGGTGGAGG - Intronic
973698157 4:53511444-53511466 TCTCAGATGGTGATGGGTGATGG + Intronic
975942701 4:79667065-79667087 TCACAGTGGGTGAAGGGTGAAGG - Intergenic
976160420 4:82192650-82192672 TCCGTGTTGGGGATGGGTAATGG - Intergenic
977051626 4:92135483-92135505 TCCCATTAGATGGTGGGTGAAGG + Intergenic
980218491 4:129882259-129882281 TTGCAGTTTGTGATGGGTGGTGG - Intergenic
981880440 4:149604856-149604878 TCCCAGGAGGTGATGGGGGGTGG + Intergenic
982088077 4:151856339-151856361 TTTCAGGTGGTGATGGGTAATGG + Intergenic
983074129 4:163304180-163304202 CCCTAGATGGTGAAGGGTGAAGG + Intergenic
985843368 5:2326236-2326258 TGCCAGCAGGTGAAGGGTGAAGG + Intergenic
987825336 5:23024003-23024025 TCCATGTTTGTTATGGGTGATGG + Intergenic
989706718 5:44341960-44341982 TACCATTTGGTGATGATTGAAGG + Intronic
990266795 5:54085533-54085555 TGCCAGTTGGTGATGAATTAGGG + Intronic
994019671 5:95008337-95008359 TCTCAATTGGTAAGGGGTGAGGG - Intronic
994139110 5:96322404-96322426 TCCCGGTTGGAGAGGGATGATGG - Intergenic
995113183 5:108450461-108450483 TCCCACTTTGTGGTGGGTCAAGG + Intergenic
998996625 5:147873739-147873761 TCCCAGTCGGTGACCGGTGCCGG + Intronic
999297350 5:150468099-150468121 TCACAAGTGGTGATGGGAGAGGG + Intergenic
1003735076 6:8869077-8869099 TCCTAGCTGGTGAGGGGTGCAGG - Intergenic
1005828409 6:29650616-29650638 TCCCATTTGGTGAGGGGGGAGGG + Intergenic
1010203022 6:73299482-73299504 TCCCAGCTGGGGAGGGGTGGGGG - Intronic
1011314618 6:86017594-86017616 ACTCAGTTTGTGATGGGTGCTGG + Intergenic
1011599853 6:89049852-89049874 TCCAAGTTGGTGATTGTTGTGGG - Intergenic
1013048026 6:106507282-106507304 TCCCAGTTGGACATGGATGATGG + Intergenic
1013293670 6:108740005-108740027 TCCCAGTTGGTGTTGGATTTTGG - Intergenic
1017120777 6:151022041-151022063 TCCCAGTGGGGGCTGGATGAAGG + Intronic
1017241406 6:152173525-152173547 TCACAGTTGAGGATGGGTGTGGG + Intronic
1017695308 6:157008827-157008849 TCACAGTTTGTAATGGGTGGTGG + Intronic
1017749925 6:157481710-157481732 CCCCAGTTGGGAATGAGTGAAGG + Intronic
1019759531 7:2800138-2800160 TCCCATTTGTTGCTGGGTAATGG - Intronic
1019929672 7:4215264-4215286 TCCCAATTGGTGGGTGGTGAAGG + Intronic
1022089737 7:27099789-27099811 TCCCAGCTGTTGATGGGTTCAGG - Intergenic
1022094953 7:27133632-27133654 TCCCAGATGGAGAAGAGTGAAGG + Intronic
1022508732 7:30922246-30922268 TCCCAGATGGAGGTGGGGGAAGG + Intronic
1024144045 7:46493040-46493062 TCCCAGAAGGTGAGAGGTGATGG + Intergenic
1024272590 7:47653941-47653963 GCCCAGCGGGTGATGGGAGAGGG - Intergenic
1024440995 7:49417266-49417288 GCACAGTGGGTGATTGGTGAAGG + Intergenic
1034700067 7:153088044-153088066 TGCCTCTTGGTGATGGCTGAAGG - Intergenic
1036620744 8:10423373-10423395 TCCCAGTCAGTGATGGGGCAGGG - Intronic
1037438910 8:18893884-18893906 TCCCCTTTAGTGATAGGTGAAGG + Intronic
1038415149 8:27389606-27389628 TCCCAGTGGGTAATGGGTGCGGG + Intronic
1039591791 8:38756218-38756240 TCACAATTGGTGATGGATGCAGG - Intronic
1040081764 8:43292321-43292343 CCCCAGTTGGTGGTGGGGGAGGG + Intergenic
1041129805 8:54685968-54685990 TAGCAGTTGGTGATGGCTGCTGG - Intergenic
1042875332 8:73435949-73435971 TTCCAAGTGGTGAGGGGTGAGGG - Intronic
1047884572 8:129234954-129234976 TCTCAGATGGTGCTAGGTGATGG + Intergenic
1048261064 8:132945418-132945440 TCCAATTTGGCGATGGGAGAGGG + Intronic
1048796047 8:138151259-138151281 TCCCAAAGGCTGATGGGTGATGG + Exonic
1049046816 8:140158947-140158969 TTCCAGTAGCTGATGGATGATGG - Intronic
1056003641 9:82243515-82243537 ACCGAGTTGGGGCTGGGTGATGG - Intergenic
1056277241 9:85005352-85005374 TCCAAGATGGTGATGGAAGACGG - Intronic
1057960150 9:99447222-99447244 CCCCAATTTGTGAAGGGTGAAGG + Intergenic
1060199773 9:121645662-121645684 TCCCAGTTTGCCATGGGTTAGGG + Intronic
1061287842 9:129634291-129634313 ATCCAGTGGGTGATAGGTGAGGG + Exonic
1203572198 Un_KI270744v1:141917-141939 TCCCAGTTGCTGTTTGGTGGAGG + Intergenic
1186581582 X:10825485-10825507 TCCCAGTAGGGTTTGGGTGAAGG - Intronic
1187151469 X:16685455-16685477 TCACATTCGGTGATGGCTGATGG - Intronic
1187498327 X:19815054-19815076 TCTTTGTGGGTGATGGGTGATGG - Intronic
1189265888 X:39715876-39715898 TCCCAGTGGGAGGTGGGTAAAGG + Intergenic
1196394645 X:115246255-115246277 GACCAGTTGGTGTTGGGTGGTGG + Intergenic
1198428966 X:136546923-136546945 TCACAGTGAGTGATGGGGGATGG - Intronic
1198952956 X:142093831-142093853 TCCCAGCTGCTGATGGTTGCCGG - Intergenic
1199712634 X:150481164-150481186 TCCCACTCAGGGATGGGTGAGGG - Intronic
1199778399 X:151035843-151035865 TCTCAGTAGGTGGTGGGGGAAGG + Intergenic
1199792257 X:151166598-151166620 TCCCACGTGGAGACGGGTGAGGG - Intergenic
1201729875 Y:17192038-17192060 CACCACTTGGTGATAGGTGATGG + Intergenic
1202075008 Y:21028559-21028581 CACCACTTGGTGATAGGTGATGG + Intergenic