ID: 1124251739

View in Genome Browser
Species Human (GRCh38)
Location 15:28110804-28110826
Sequence CTGTGCAGACAGATGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124251733_1124251739 -1 Left 1124251733 15:28110782-28110804 CCAATGAAAGCAGAAGCCAAGGC No data
Right 1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG No data
1124251730_1124251739 5 Left 1124251730 15:28110776-28110798 CCCAGGCCAATGAAAGCAGAAGC No data
Right 1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG No data
1124251731_1124251739 4 Left 1124251731 15:28110777-28110799 CCAGGCCAATGAAAGCAGAAGCC No data
Right 1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG No data
1124251728_1124251739 25 Left 1124251728 15:28110756-28110778 CCTGGACGGAAGACTCTCAGCCC No data
Right 1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124251739 Original CRISPR CTGTGCAGACAGATGGGGCT GGG Intergenic
No off target data available for this crispr