ID: 1124254849

View in Genome Browser
Species Human (GRCh38)
Location 15:28132040-28132062
Sequence CTCACCGCAGTCGGGCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 131}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124254849_1124254858 7 Left 1124254849 15:28132040-28132062 CCTGGGGGCCCGACTGCGGTGAG 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1124254858 15:28132070-28132092 AGCACTGGGCAGGGAAAGAATGG 0: 1
1: 0
2: 6
3: 61
4: 587
1124254849_1124254857 -2 Left 1124254849 15:28132040-28132062 CCTGGGGGCCCGACTGCGGTGAG 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1124254857 15:28132061-28132083 AGCTGGGAGAGCACTGGGCAGGG 0: 1
1: 0
2: 4
3: 57
4: 519
1124254849_1124254859 8 Left 1124254849 15:28132040-28132062 CCTGGGGGCCCGACTGCGGTGAG 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1124254859 15:28132071-28132093 GCACTGGGCAGGGAAAGAATGGG 0: 1
1: 0
2: 5
3: 50
4: 373
1124254849_1124254855 -7 Left 1124254849 15:28132040-28132062 CCTGGGGGCCCGACTGCGGTGAG 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1124254855 15:28132056-28132078 CGGTGAGCTGGGAGAGCACTGGG 0: 1
1: 0
2: 1
3: 14
4: 204
1124254849_1124254860 23 Left 1124254849 15:28132040-28132062 CCTGGGGGCCCGACTGCGGTGAG 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1124254860 15:28132086-28132108 AGAATGGGAAATACCTTCATAGG 0: 1
1: 0
2: 1
3: 26
4: 249
1124254849_1124254856 -3 Left 1124254849 15:28132040-28132062 CCTGGGGGCCCGACTGCGGTGAG 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1124254856 15:28132060-28132082 GAGCTGGGAGAGCACTGGGCAGG 0: 1
1: 0
2: 9
3: 67
4: 584
1124254849_1124254854 -8 Left 1124254849 15:28132040-28132062 CCTGGGGGCCCGACTGCGGTGAG 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1124254854 15:28132055-28132077 GCGGTGAGCTGGGAGAGCACTGG 0: 1
1: 0
2: 1
3: 29
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124254849 Original CRISPR CTCACCGCAGTCGGGCCCCC AGG (reversed) Intronic